Frequency Of The Allelic Variant C.1150t > C In Exon 10 Of The Fibroblast Growth Factor Receptor 3 (fgfr3) Gene Is Not Increased In Patients With Pathogenic Mutations And Related Chondrodysplasia Phenotypes.

Mutations in the FGFR3 gene cause the phenotypic spectrum of FGFR3 chondrodysplasias ranging from lethal forms to the milder phenotype seen in hypochondroplasia (Hch). The p.N540K mutation in the FGFR3 gene occurs in ∼70% of individuals with Hch, and nearly 30% of individuals with the Hch phenotype have no mutations in the FGFR3, which suggests genetic heterogeneity. The identification of a severe case of Hch associated with the typical mutation c.1620C > A and the occurrence of a c.1150T > C change that resulted in a p.F384L in exon 10, together with the suspicion that this second change could be a modulator of the phenotype, prompted us to investigate this hypothesis in a cohort of patients. An analysis of 48 patients with FGFR3 chondrodysplasia phenotypes and 330 healthy (control) individuals revealed no significant difference in the frequency of the C allele at the c.1150 position (p = 0.34). One patient carrying the combination `pathogenic mutation plus the allelic variant c.1150T > C' had a typical achondroplasia (Ach) phenotype. In addition, three other patients with atypical phenotypes showed no association with the allelic variant. Together, these results do not support the hypothesis of a modulatory role for the c.1150T > C change in the FGFR3 gene.

Chronic Continuous Exenatide Infusion Does Not Cause Pancreatic Inflammation And Ductal Hyperplasia In Non-human Primates.

In this study, we aimed to evaluate the effects of exenatide (EXE) treatment on exocrine pancreas of nonhuman primates. To this end, 52 baboons (Papio hamadryas) underwent partial pancreatectomy, followed by continuous infusion of EXE or saline (SAL) for 14 weeks. Histological analysis, immunohistochemistry, Computer Assisted Stereology Toolbox morphometry, and immunofluorescence staining were performed at baseline and after treatment. The EXE treatment did not induce pancreatitis, parenchymal or periductal inflammatory cell accumulation, ductal hyperplasia, or dysplastic lesions/pancreatic intraepithelial neoplasia. At study end, Ki-67-positive (proliferating) acinar cell number did not change, compared with baseline, in either group. Ki-67-positive ductal cells increased after EXE treatment (P = 0.04). However, the change in Ki-67-positive ductal cell number did not differ significantly between the EXE and SAL groups (P = 0.13). M-30-positive (apoptotic) acinar and ductal cell number did not change after SAL or EXE treatment. No changes in ductal density and volume were observed after EXE or SAL. Interestingly, by triple-immunofluorescence staining, we detected c-kit (a marker of cell transdifferentiation) positive ductal cells co-expressing insulin in ducts only in the EXE group at study end, suggesting that EXE may promote the differentiation of ductal cells toward a β-cell phenotype. In conclusion, 14 weeks of EXE treatment did not exert any negative effect on exocrine pancreas, by inducing either pancreatic inflammation or hyperplasia/dysplasia in nonhuman primates.

The C-terminal Region Of The Human P23 Chaperone Modulates Its Structure And Function.

The p23 protein is a chaperone widely involved in protein homeostasis, well known as an Hsp90 co-chaperone since it also controls the Hsp90 chaperone cycle. Human p23 includes a β-sheet domain, responsible for interacting with Hsp90; and a charged C-terminal region whose function is not clear, but seems to be natively unfolded. p23 can undergo caspase-dependent proteolytic cleavage to form p19 (p231-142), which is involved in apoptosis, while p23 has anti-apoptotic activity. To better elucidate the function of the human p23 C-terminal region, we studied comparatively the full-length human p23 and three C-terminal truncation mutants: p23₁₋₁₁₇; p23₁₋₁₃₁ and p23₁₋₁₄₂. Our data indicate that p23 and p19 have distinct characteristics, whereas the other two truncations behave similarly, with some differences to p23 and p19. We found that part of the C-terminal region can fold in an α-helix conformation and slightly contributes to p23 thermal-stability, suggesting that the C-terminal interacts with the β-sheet domain. As a whole, our results suggest that the C-terminal region of p23 is critical for its structure-function relationship. A mechanism where the human p23 C-terminal region behaves as an activation/inhibition module for different p23 activities is proposed.

Avaliação do teor e da estabilidade de vitaminas do complexo B e vitamina C em bebidas isotônicas e energéticas

Vitamin C stability and concentration was evaluated in isotonic beverages and B group vitamins (B1, B2, B3, B5 and B6) in power beverages. The amount of vitamins was found to be above of that declared on the labels, even after the shelf life had been exceeded. A small decrease in the amount of B group vitamins was observed during the shelf life of the products. In the case of vitamin C this decrease was slightly higher. The present research shows the need of increased quality control and inspection.

Caracterização físico-química de filmes comestíveis de amido adicionado de acerola (Malphigia emarginata D.C.)

Edibles films are an alternative to synthetic materials used for packing food products. Barbados cherry is rich in vitamin C and carotenoids. The aim of this study was to characterize and develop films by casting from cassava starch, lyophilized Barbados cherry pulp and glycerol. The films were characterized with respect to thickness, water vapor permeability (WVP), water solubility, vitamin C, carotene and mechanical properties. The interaction of pulp and glycerol reduced film thickness. An increase in pulp concentration up to 60% increased WVP but beyond this concentration reduced both WVP and solubility leading to an increased level of vitamin C and β carotene in the films.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O uso da mitomicina C em cirurgia combinada

Purpose: To analyze the efficacy and safety of intraope-rative mitomycin C (MMC) in combined procedures (extra-capsular cataract extraction + trabeculectomy). Methods: Twenty-four patients were randomized to either MMC (0.5 mg/ml) (n = 14) or saline solution (n = 10) for 3 minutes during the combined procedure. Results: Twelve months after surgery, mean IOP in the MMC group (13.2 ± 2.9 mmHg) was significantly lower than in the control group (16.3 ± 3.9 mmHg) (p = 0.02). The mean number of medications used during the 12-month follow-up in the control group (1.33 ± 0.5) was significantly higher than in the MMC-treated group (0.5 ± 0.5) (p = 0.005). Life table analysis showed a significantly higher probability of IOP control in the MMC group than in the control group (p < 0.01). Conclusions: Intraoperative MMC is safe and effective in pro-moting a better IOP control and reducing the need for postoperative antiglaucoma medications. We suggest intraope-rative MMC to be routinely employed in combined procedures.

Central retinal vein thrombosis as an initial manifestation of heterozygous protein C deficiency: case report

The purpose of this paper is to report a case of central retinal vein thrombosis associated with isolated heterozygous protein C deficiency. Acute occlusion of the central retinal vein presents as one of the most dramatic pictures in ophthalmology. It is often a result of both local and systemic causes. A rare systemic cause is heterozygous protein C deficiency, and it usually occurs in combination with other thrombophilic conditions. This case highlights that isolated heterozygous protein C deficiency may be the cause of central retinal vein thrombosis and underscores the importance of its screening in young patients with this ophthalmologic disease.

O papel do trabalho na transformação do homem em macaco : estudo sobre a disciplina no trabalho do jogador profissional do Sertãozinho F. C

Universidade Estadual de Campinas. Faculdade de Educação Física

Atividade fisica e a relação com a qualidade de vida, ansiedade e depressão em pessoas com sequelas de acidente vascular cerebral isquemico (AVCI)/ c Alberto Martins da Costa

Universidade Estadual de Campinas . Faculdade de Educação Física

Effect of staining solutions and repolishing on color stability of direct composites

OBJECTIVES: The purpose of this study was to assess the color change of three types of composite resins exposed to coffee and cola drink, and the effect of repolishing on the color stability of these composites after staining. MATERIALS AND METHODS: Fifteen specimens (15 mm diameter and 2 mm thick) were fabricated from microhybrid (Esthet-X; Dentsply and Filtek Z-250; 3M ESPE) and high-density hybrid (Surefil; Dentsply) composites, and were finished and polished with aluminum oxide discs (Sof-Lex; 3M ESPE). Color of the specimens was measured according to the CIE L*a*b* system in a refection spectrophotometer (PCB 6807; BYK Gardner). After baseline color measurements, 5 specimens of each resin were immersed in different staining solutions for 15 days: G1 - distilled water (control), G2 - coffee, G3 - cola soft drink. Afterwards, new color measurement was performed and the specimens were repolished and submitted to new color reading. Color stability was determined by the difference (ΔE) between the coordinates L*, a*, and b* obtained from the specimens before and after immersion into the solutions and after repolishing. RESULTS: There was no statistically signifcant difference (ANOVA, Tukey's test; p>0.05) among the ΔE values for the different types of composites after staining or repolishing. For all composite resins, coffee promoted more color change (ΔE>3.3) than distilled water and the cola soft drink. After repolishing, the ΔE values of the specimens immersed in coffee decreased to clinically acceptable values (ΔE<3.3), but remained signifcantly higher than those of the other groups. CONCLUSIONS: No signifcant difference was found among composite resins or between color values before and after repolishing of specimens immersed in distilled water and cola. Immersing specimens in coffee caused greater color change in all types of composite resins tested in this study and repolishing contributed to decrease staining to clinically acceptable ΔE values.

Influence of surface sealant on the translucency of composite resin: effect of immersion time and immersion media

This study evaluated the effect of surface sealant on the translucency of composite resin immersed in different solutions. The study involved the following materials: Charisma, Fortify and coffee, Coca-Cola®, tea and artificial saliva as solutions. Sixty-four specimens (n = 8) were manufactured and immersed in artificial saliva at 37 ± 1 °C. Samples were immersed in the solutions for three times a day and re-immersed in artificial saliva until the translucency readings. The measurements were carried out at nine times: T1 - 24 hours after specimen preparation, T2 - 24 hours after immersion in the solutions, T3 - 48 hours and T4 to T9 - 7, 14, 21, 30, 60 and 90 days, respectively, after immersion. The translucency values were measured using a JOUAN device. The results were subjected to ANOVA and Tukey's test at 5%. The surface sealant was not able to protect the composite resin against staining, the coffee showed the strongest staining action, followed by tea and regarding immersion time, a significant alteration was noted in the translucency of composite resin after 21 days.

Estabilidade oxidativa e microbiológica em carne de galinha mecanicamente separada e adicionada de antioxidantes durante período de armazenamento a -18 °C

Com o objetivo de acompanhar a estabilidade físico-química e microbiológica da carne mecanicamente separada (CMS) de diferentes origens e estocada durante 99 dias a -18 °C, foi realizada prévia mistura de conservante (nitrito de sódio) e antioxidante (eritorbato de sódio) em CMS obtida de duas linhagens de aves: galinhas matrizes de corte e galinhas poedeiras comerciais brancas. Na CMS de cada linhagem foram realizados três diferentes tratamentos: 1) controle (sem aditivos); 2) adição de 150 ppm de nitrito; e 3) adição de 150 ppm de nitrito e 500 ppm de eritorbato. Os resultados encontrados demonstraram que a adição de nitrito isoladamente não impediu a oxidação lipídica, avaliada através do índice de TBARS, nem a alteração na cor, avaliada em colorímetro. Por outro lado, a adição de nitrito juntamente com eritorbato foi efetiva na redução dos problemas de oxidação lipídica na CMS de galinhas matrizes, e em menor grau, na CMS de poedeiras. A adição de nitrito e eritorbato na CMS também melhorou a preservação da cor vermelha desejável (a*) ao longo do tempo. A avaliação da estabilidade microbiológica da CMS, realizada no primeiro e último dia de estocagem congelada, para microrganismos mesófilos, Escherichia coli, Staphylococcus aureus, Clostridium perfringens e Pseudomonas spp., e quinzenalmente para microrganismos psicrotróficos, indicou que não houve uma variação significativa nas contagens em função do tratamento utilizado (diferentes aditivos adicionados). Não foi detectada Salmonella spp. em nenhuma das amostras analisadas. Em função da melhoria da estabilidade oxidativa, recomenda-se a adição de nitrito (150 ppm) e eritorbato (500 ppm) em CMS de galinhas matrizes a ser estocada congelada por um período prolongado.

Vitaminas D e C para poedeiras na fase inicial de produção de ovos

Um experimento foi conduzido com o objetivo de avaliar os efeitos de duas fontes de vitamina D e três níveis de vitamina C sobre as características de desempenho, a qualidade interna e externa dos ovos, os níveis de cálcio total e iônico séricos e a resistência óssea de poedeiras. Foram utilizadas 288 galinhas da linhagem ISA Babcock B300® com 23 semanas de idade, durante um período experimental de 12 semanas. Utilizou-se o delineamento inteiramente ao acaso em arranjo fatorial 2 × 3, com os fatores: fontes de vitamina D (colecalciferol e 25-hidroxicolecalciferol - 25(OH)D3) e de vitamina C (0, 100 e 200 ppm), totalizando seis tratamentos com oito repetições de seis aves. O nível basal de colecalciferol foi de 2.756 UI/kg, correspondendo a 5,51 g do produto comercial Hy.D®/t de ração, como fonte de 25(OH)D3. Os fatores estudados não influenciaram o consumo de ração, a produção, o peso e a massa de ovos. Observou-se efeito da interação de fontes de vitamina sobre a conversão alimentar, que foi melhor quando utilizado metabólito 25(OH)D3 na ausência de vitamina C. Interações foram observadas para porcentagem de albúmen e porcentagem de gema, que aumentaram na presença de 200 ppm de vitamina C. O peso específico dos ovos, as concentrações de cálcio sérico, cinzas ósseas e a resistência à quebra não foram influenciadas pelas fontes de vitamina D e C. Houve interação para porcentagem e espessura de casca, cujos maiores valores foram obtidos com a suplementação de vitamina C na presença de 25(OH)D3. Em poedeiras na fase inicial de produção, a conversão alimentar é melhor com a utilização do 25(OH)D3 e a espessura e porcentagem de casca também melhoram com a utilização de 25(OH)D3 e a suplementação de vitamina C nas dietas (100 ou 200 ppm, respectivamente).

Alterações do trato digestório de cães da raça Golden Retriever afetados pela distrofia muscular

O modelo experimental canino Golden Retriever portador da Distrofia Muscular (GRMD) é o melhor substituto entre os modelos animais para estudar a Distrofia Muscular de Duchenne. Além da musculatura estriada, a doença pode afetar a musculatura estriada cardíaca e a musculatura lisa, e desta forma, o funcionamento do trato digestório, já que o músculo liso é o elemento primário dos órgãos tubulares. Através de estudo morfológico descritivo, o objetivo deste trabalho foi verificar se a distrofia muscular afeta a arquitetura geral do trato digestório e como se dispõe sua estrutura muscular em animais afetados. Foram realizadas avaliações descritivas macro e microscópicas com colorações de Hematoxilina-Eosina, Tricrômio de Masson e Picrosirius. Entre os resultados apresentados, verificou-se que o esôfago e o fígado dos animais afetados encontraram-se alterados, assim como o estômago não ocupava seu lugar habitual. O músculo diafragma apresentava-se atrofiado e diferenças histológicas foram encontradas na camada muscular do sistema gastrointestinal, em geral. Outras estruturas do tubo digestório de GRMDs apresentaram-se de maneira similar a de um animal normal.