850 resultados para Duplex circulator
Resumo:
Mitochondria are responsible for producing the vast majority of cellular ATP, and are therefore critical to organismal health [1]. They contain thir own genomes (mtDNA) which encode 13 proteins that are all subunits of the mitochondrial respiratory chain (MRC) and are essential for oxidative phosphorylation [2]. mtDNA is present in multiple copies per cell, usually between 103 and 104 , though this number is reduced during certain developmental stages [3, 4]. The health of the mitochondrial genome is also important to the health of the organism, as mutations in mtDNA lead to human diseases that collectively affect approximately 1 in 4000 people [5, 6]. mtDNA is more susceptible than nuclear DNA (nucDNA) to damage by many environmental pollutants, for reasons including the absence of Nucleotide Excision Repair (NER) in the mitochondria [7]. NER is a highly functionally conserved DNA repair pathway that removes bulky, helix distorting lesions such as those caused by ultraviolet C (UVC) radiation and also many environmental toxicants, including benzo[a]pyrene (BaP) [8]. While these lesions cannot be repaired, they are slowly removed through a process that involves mitochondrial dynamics and autophagy [9, 10]. However, when present during development in C. elegans, this damage reduces mtDNA copy number and ATP levels [11]. We hypothesize that this damage, when present during development, will result in mitochondrial dysfunction and increase the potential for adverse outcomes later in life.
To test this hypothesis, 1st larval stage (L1) C. elegans are exposed to 3 doses of 7.5J/m2 ultraviolet C radiation 24 hours apart, leading to the accumulation of mtDNA damage [9, 11]. After exposure, many mitochondrial endpoints are assessed at multiple time points later in life. mtDNA and nucDNA damage levels and genome copy numbers are measured via QPCR and real-time PCR , respectively, every 2 day for 10 days. Steady state ATP levels are measured via luciferase expressing reporter strains and traditional ATP extraction methods. Oxygen consumption is measured using a Seahorse XFe24 extra cellular flux analyzer. Gene expression changes are measured via real time PCR and targeted metabolomics via LC-MS are used to investigate changes in organic acid, amino acid and acyl-carnitine levels. Lastly, nematode developmental delay is assessed as growth, and measured via imaging and COPAS biosort.
I have found that despite being removed, UVC induced mtDNA damage during development leads to persistent deficits in energy production later in life. mtDNA copy number is permanently reduced, as are ATP levels, though oxygen consumption is increased, indicating inefficient or uncoupled respiration. Metabolomic data and mutant sensitivity indicate a role for NADPH and oxidative stress in these results, and exposed nematodes are more sensitive to the mitochondrial poison rotenone later in life. These results fit with the developmental origin of health and disease hypothesis, and show the potential for environmental exposures to have lasting effects on mitochondrial function.
Lastly, we are currently working to investigate the potential for irreparable mtDNA lesions to drive mutagenesis in mtDNA. Mutations in mtDNA lead to a wide range of diseases, yet we currently do not understand the environmental component of what causes them. In vitro evidence suggests that UVC induced thymine dimers can be mutagenic [12]. We are using duplex sequencing of C. elegans mtDNA to determine mutation rates in nematodes exposed to our serial UVC protocol. Furthermore, by including mutant strains deficient in mitochondrial fission and mitophagy, we hope to determine if deficiencies in these processes will further increase mtDNA mutation rates, as they are implicated in human diseases.
Resumo:
Hoogsteen (HG) base pairs (bps) provide an alternative pairing geometry to Watson-Crick (WC) bps and can play unique functional roles in duplex DNA. Here, we use structural features unique to HG bps (syn purine base, HG hydrogen bonds and constricted C1'-C1' distance across the bp) to search for HG bps in X-ray structures of DNA duplexes in the Protein Data Bank. The survey identifies 106 A•T and 34 G•C HG bps in DNA duplexes, many of which are undocumented in the literature. It also uncovers HG-like bps with syn purines lacking HG hydrogen bonds or constricted C1'-C1' distances that are analogous to conformations that have been proposed to populate the WC-to-HG transition pathway. The survey reveals HG preferences similar to those observed for transient HG bps in solution by nuclear magnetic resonance, including stronger preferences for A•T versus G•C bps, TA versus GG steps, and also suggests enrichment at terminal ends with a preference for 5'-purine. HG bps induce small local perturbations in neighboring bps and, surprisingly, a small but significant degree of DNA bending (∼14°) directed toward the major groove. The survey provides insights into the preferences and structural consequences of HG bps in duplex DNA.
Resumo:
This work combines microscopy, synchrotron radiation X-ray diffraction, differential scanning calorimetry and thermodynamic calculations in the characterisation of phase transformation behaviour of a Ti–46Al–1.9Cr–3Nb alloy upon continuous heating at constant rates. It has been found that the Ti–46Al–1.9Cr–3Nb alloy after being forged at 1200 °C without further treatment has a duplex microstructure consisting of fine equiaxed and lamellar ? grains with a small amount of a2 plates and particles and about 1 wt.% B2 phase. Differential scanning calorimetry revealed reproducibly several thermal effects upon heating of the as-forged alloy. These thermal effects are related to the equilibration and homogenisation of the sample, change of phase ratios between a2, ? and B2 phases in particular the increase of B2 in respect to a2 and ?, and the following five phase transformations: a2 + ? + B2 a + ? + B2, a + ? + B2 a + ?, ? + a a, a a + ß, a + ß a + ß + L. The observation of these transformations by differential scanning calorimetry is largely in agreement with literature phase diagrams and thermodynamic calculations, though care is needed to consider the different alloy compositions. Kinetics of the ? + a a phase transformation in the Ti–46Al–1.9Cr–3Nb alloy has been quantitatively derived from the calorimetry data, giving phase compositions at any point during the transformation upon continuous heating.
Resumo:
Reality shows are TV programs which represent a format used in television nowadays; however, the observation practices of individual and/or group intimacy dates from thousands years ago. Sometimes this was driven by voyeurism or morbid fascination, some others, by the purpose of guarding, supervising and maintaining status quo. This work offers an alternative answer to the explanation of this type of TV program emergence and relates this appearance to a government procedure bound up with modern State terrorism which began at the end of the eighteenth century and has been recalled by different regimes until present days.
Multiple Enzymatic Activities Associated with Severe Acute Respiratory Syndrome Coronavirus Helicase
Resumo:
Severe acute respiratory syndrome coronavirus (SARS-CoV), a newly identified group 2 coronavirus, is the causative agent of severe acute respiratory syndrome, a life-threatening form of pneumonia in humans. Coronavirus replication and transcription are highly specialized processes of cytoplasmic RNA synthesis that localize to virus-induced membrane structures and were recently proposed to involve a complex enzymatic machinery that, besides RNA-dependent RNA polymerase, helicase, and protease activities, also involves a series of RNA-processing enzymes that are not found in most other RNA virus families. Here, we characterized the enzymatic activities of a recombinant form of the SARS-CoV helicase (nonstructural protein [nsp] 13), a superfamily 1 helicase with an N-terminal zinc-binding domain. We report that nsp13 has both RNA and DNA duplex-unwinding activities. SARS-CoV nsp13 unwinds its substrates in a 5'-to-3' direction and features a remarkable processivity, allowing efficient strand separation of extended regions of double-stranded RNA and DNA. Characterization of the nsp13-associated (deoxy)nucleoside triphosphatase ([dNTPase) activities revealed that all natural nucleotides and deoxynucleotides are substrates of nsp13, with ATP, dATP, and GTP being hydrolyzed slightly more efficiently than other nucleotides. Furthermore, we established an RNA 5'-triphosphatase activity for the SARS-CoV nsp13 helicase which may be involved in the formation of the 5' cap structure of viral RNAs. The data suggest that the (d)NTPase and RNA 5'-triphosphatase activities of nsp13 have a common active site. Finally, we established that, in SARS-CoV-infected Vero E6 cells, nsp13 localizes to membranes that appear to be derived from the endoplasmic reticulum and are the likely site of SARS-CoV RNA synthesis.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.
Resumo:
The arterivirus equine arteritis virus nonstructural protein 10 (nsp10) has previously been predicted to contain a Zn finger structure linked to a superfamily 1 (SF1) helicase domain. A recombinant form of nsp10, MBP-nsp10, was produced in Escherichia coli as a fusion protein with the maltose-binding protein. The protein was partially purified by affinity chromatography and shown to have ATPase activity that was strongly stimulated by poly(dT), poly(U), and poly(dA) but not by poly(G). The protein also had both RNA and DNA duplex-unwinding activities that required the presence of 5' single-stranded regions on the partial-duplex substrates, indicating a 5'-to-3' polarity in the unwinding reaction. Results of this study suggest a close functional relationship between the arterivirus nsp10 and the coronavirus helicase, for which NTPase and duplex-unwinding activities were recently demonstrated. In a number of biochemical properties, both arterivirus and coronavirus SF1 helicases differ significantly from the previously characterized RNA virus SF1 and SF2 enzymes. Thus, the combined data strongly support the idea that nidovirus helicases may represent a separate group of RNA virus-encoded helicases with distinct properties.
Resumo:
This paper details the implementation and operational performance of a minimum-power 2.45-GHz pulse receiver and a companion on-off keyed transmitter for use in a semi-active duplex RF biomedical transponder. A 50-Ohm microstrip stub-matched zero-bias diode detector forms the heart of a body-worn receiver that has a CMOS baseband amplifier consuming 20 microamps from +3 V and achieves a tangential sensitivity of -53 dBm. The base transmitter generates 0.5 W of peak RF output power into 50 Ohms. Both linear and right-hand circularly polarized Tx-Rx antenna sets were employed in system reliability trials carried out in a hospital Coronary Care Unit, For transmitting antenna heights between 0.3 and 2.2 m above floor level, transponder interrogations were 95% reliable within the 67-m-sq area of the ward, falling to an average of 46 % in the surrounding rooms and corridors. Overall, the circular antenna set gave the higher reliability and lower propagation power decay index.
Resumo:
Structure-based modeling methods have been used to design a series of disubstituted triazole-linked acridine compounds with selectivity for human telomeric quadruplex DNAs. A focused library of these compounds was prepared using click chemistry and the selectivity concept was validated against two promoter quadruplexes from the c-kit gene with known molecular structures, as well as with duplex DNA using a FRET-based melting method. Lead compounds were found to have reduced effects on the thermal stability of the c-kit quadruplexes and duplex DNA structures. These effects were further explored with a series of competition experiments, which confirmed that binding to duplex DNA is very low even at high duplex:telomeric quadruplex ratios. Selectivity to the c-kit quadruplexes is more complex, with some evidence of their stabilization at increasing excess over human telomeric quadruplex DNA. Selectivity is a result of the dimensions of the triazole-acridine compounds; and in particular the separation of the two alkyl-amino terminal groups. Both lead compounds also have selective inhibitory effects on the proliferation of cancer cell lines compared to a normal cell line, and one has been shown to inhibit the activity of the telomerase enzyme, which is selectively expressed in tumor cells, where it plays a role in maintaining telomere integrity and cellular immortalization.
Resumo:
A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.
Resumo:
We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.
Resumo:
Maintenance of telomeres—specialized complexes that protect the ends of chromosomes, is undertaken by the enzyme complex telomerase, which is a key factor that is activated in more than 80% of cancer cells, but is absent in most normal cells. Targeting telomere maintenance mechanisms could potentially halt tumour growth across a broad spectrum of cancer types, with little cytotoxic effect outside cancer cells. Here, we describe in detail a new class of G-quadruplex binding ligands synthesized using a click chemistry approach. These ligands comprise a 1,3-di(1,2,3-triazol-4-yl)benzene pharmacophore, and display high levels of selectivity for interaction with G-quadruplex DNA vs. duplex DNA. The ability of these ligands to inhibit the enzymatic activity of telomerase correlates with their ability to stabilize quadruplex DNA, and with estimates of affinity calculated by molecular modeling.
Resumo:
A fluorescent anthracene-tagged DNA probe has been shown to respond to various DNA sequences by changes to its emission signal upon duplex formation. The fluorescence response for duplexes containing a single mismatch near the anthracene site has been found to be very sensitive to its composition, with the emission signal increasing for a CA mismatch and decreasing for CT and CC mismatches.
Resumo:
The present study has employed a combination of spectroscopic, calorimetric and computational methods to explore the binding of the three side-chained triazatruxene derivative, termed azatrux, to a human telomeric G-quadruplex sequence, under conditions of molecular crowding. The binding of azatrux to the tetramolecular parallel [d(TGGGGT)](4) quadruplex in the presence and absence of crowding conditions, was also characterized. The data indicate that azatrux binds in an end-stacking mode to the parallel G-quadruplex scaffold and highlights the key structural elements involved in the binding. The selectivity of azatrux for the human telomeric G-quadruplex relative to another biologically relevant G-quadruplex (c-Kit87up) and to duplex DNA was also investigated under molecular crowding conditions, showing that azatrux has good selectivity for the human telomeric G-quadruplex over the other investigated DNA structures. (C) 2011 Elsevier Masson SAS. All rights reserved.