975 resultados para specific combining ability


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The association between tridimensional scaffolds to cells of interest has provided excellent perspectives for obtaining viable complex tissues in vitro, such as skin, resulting in impressive advances in the field of tissue engineering applied to regenerative therapies. The use of multipotent mesenchymal stromal cells in the treatment of dermo-epidermal wounds is particularly promising due to several relevant properties of these cells, such as high capacity of proliferation in culture, potential of differentiation in multiple skin cell types, important paracrine and immunomodulatory effects, among others. Membranes of chitosan complexed with xanthan may be potentially useful as scaffolds for multipotent mesenchymal stromal cells, given that they present suitable physico-chemical characteristics and have adequate tridimensional structure for the adhesion, growth, and maintenance of cell function. Therefore, the purpose of this work was to assess the applicability of bioactive dressings associating dense and porous chitosan-xanthan membranes to multipotent mesenchymal stromal cells for the treatment of skin wounds. The membranes showed to be non-mutagenic and allowed efficient adhesion and proliferation of the mesenchymal stromal cells in vitro. In vivo assays performed with mesenchymal stromal cells grown on the surface of the dense membranes showed acceleration of wound healing in Wistar rats, thus indicating that the use of this cell-scaffold association for tissue engineering purposes is feasible and attractive.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Avian Pathogenic Escherichia coli (APEC) strains are extra-intestinal E. coli that infect poultry and cause diseases. Nitrite is a central branch-point in bacterial nitrogen metabolism and is used as a cytotoxin by macrophages. Unlike nitric oxide (NO), nitrite cannot diffuse across bacterial membrane cells. The NirC protein acts as a specific channel to facilitate the transport of nitrite into Salmonella and E. coli cells for nitrogen metabolism and cytoplasmic detoxification. NirC is also required for the pathogenicity of Salmonella by downregulating the production of NO by the host macrophages. Based on an in vitro microarray that revealed the overexpression of the nirC gene in APEC strain SCI-07, we constructed a nirC-deficient SCI-07 strain (ΔnirC) and evaluated its virulence potential using in vivo and in vitro assays. The final cumulative mortalities caused by mutant and wild-type (WT) were similar; while the ΔnirC caused a gradual increase in the mortality rate during the seven days recorded, the WT caused mortality up to 24h post-infection (hpi). Counts of the ΔnirC cells in the spleen, lung and liver were higher than those of the WT after 48 hpi but similar at 24 hpi. Although similar number of ΔnirC and WT cells was observed in macrophages at 3 hpi, there was higher number of ΔnirC cells at 16 hpi. The cell adhesion ability of the ΔnirC strain was about half the WT level in the presence and absence of alpha-D-mannopyranoside. These results indicate that the nirC gene influences the pathogenicity of SCI-07 strain.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJETIVO: Analisar os fatores relacionados à determinação e às desigualdades no acesso e uso dos serviços de saúde por idosos. MÉTODOS: Estudo integrante do Projeto Saúde, Bem-estar e Envelhecimento (SABE), no qual foram entrevistados 2.143 indivíduos com 60 anos ou mais no município de São Paulo, SP, em 2000. A amostra foi obtida em dois estágios, utilizando-se setores censitários com reposição, probabilidade proporcional à população e complementação da amostra de pessoas de 75 anos. Foi mensurado o uso de serviços hospitalares e ambulatoriais nos quatro meses anteriores à entrevista, relacionando-os com fatores de capacidade, necessidade e predisposição (renda total, escolaridade, seguro saúde, morbidade referida, auto-percepção, sexo e idade). O método estatístico utilizado foi regressão logística multivariada. RESULTADOS: Dos entrevistados, 4,7% referiram ter utilizado a internação hospitalar e 64,4% o atendimento ambulatorial. Dos atendimentos ambulatoriais em serviço público, 24,7% ocorreram em hospital e 24,1% em serviço ambulatorial; dentre os que ocorreram em serviços privados, 14,5% foram em hospital e 33,7% em clínicas. Pela análise multivariada, observou-se associação entre a utilização de serviços e sexo, presença de doenças, auto-percepção de saúde, interação da renda e escolaridade e posse de seguro saúde. A análise isolada com escolaridade apresentou efeito inverso. CONCLUSÕES: Foram observadas desigualdades no uso e acesso aos serviços de saúde e inadequação do modelo de atenção, indicando necessidade de políticas públicas que levem em conta as especificidades dessa população, facilitem o acesso e possam reduzir essas desigualdades.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to evaluate the ability of the BANA Test to detect different levels of Porphyromonas gingivalis, Treponema denticola and Tannerella forsythia or their combinations in subgingival samples at the initial diagnosis and after periodontal therapy. Periodontal sites with probing depths between 5-7 mm and clinical attachment level between 5-10 mm, from 53 subjects with chronic periodontitis, were sampled in four periods: initial diagnosis (T0), immediately (T1), 45 (T2) and 60 days (T3) after scaling and root planing. BANA Test and Checkerboard DNA-DNA hybridization identified red complex species in the subgingival biofilm. In all experimental periods, the highest frequencies of score 2 (Checkerboard DNA-DNA hybridization) for P. gingivalis, T. denticola and T. forsythia were observed when strong enzymatic activity (BANA) was present (p < 0.01). The best agreement was observed at initial diagnosis. The BANA Test sensitivity was 95.54% (T0), 65.18% (T1), 65.22% (T2) and 50.26% (T3). The specificity values were 12.24% (T0), 57.38% (T1), 46.27% (T2) and 53.48% (T3). The BANA Test is more effective for the detection of red complex pathogens when the bacterial levels are high, i.e. in the initial diagnosis of chronic periodontitis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

OBJETIVO: Identificar na literatura situações que possam impedir ou prejudicar as ações de prevenção de acidentes e doenças ou de promoção da saúde de trabalhadores do setor saúde. MÉTODO: Foi realizada uma revisão da literatura utilizando a base SciELO para o período de 1967 a 2008, complementada por busca na base PubMed para o período de 1950 a 2008. Os seguintes termos foram utilizados para identificar artigos em português, inglês e espanhol: trabalho, trabalhador, ocupacional, riscos, doenças, ergonomia, capacidade para o trabalho, qualidade de vida, organização, acidentes, condições de trabalho, intervenção e administração. Foram selecionados artigos sobre prevenção de doenças e acidentes e sobre promoção da saúde no trabalho em serviços de saúde latino-americanos. Também foram selecionados artigos sobre intervenções em ambientes de trabalho no setor saúde. RESULTADOS: Foram identificadas as seguintes situações desfavoráveis: programas de intervenção sem boa base teórica e não integrados à gestão do serviço como um todo; falhas em avaliar a eficácia das intervenções; vigilância da saúde restrita a doenças e agravos específicos; falta de compromisso da gestão com as intervenções; falhas na comunicação; falta de participação e controle por parte dos trabalhadores sobre o ambiente de trabalho; e programas e intervenções baseados exclusivamente na mudança comportamental dos trabalhadores. CONCLUSÕES: A literatura mostra que todas as barreiras citadas afetam tanto a melhoria do estado de saúde dos trabalhadores em saúde quanto a sua capacidade para o trabalho

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose To test the association between night work and work ability, and verify whether the type of contractual employment has any inXuence over this association. Methods Permanent workers (N = 642) and workers with precarious jobs (temporary contract or outsourced; N = 552) were interviewed and Wlled out questionnaires concerning work hours and work ability index. They were classiWed into: never worked at night, ex-night workers, currently working up to Wve nights, and currently working at least six nights/2-week span. Results After adjusting for socio-demography and work variables, current night work was signiWcantly associated with inadequate WAI (vs. day work with no experience in night work) only for precarious workers (OR 2.00, CI 1.01- 3.95 and OR 1.85, CI 1.09-3.13 for those working up to Wve nights and those working at least six nights in 2 weeks, respectively). Conclusions Unequal opportunities at work and little experience in night work among precarious workers may explain their higher susceptibility to night work