990 resultados para BIOLOGICAL DETECTION
Resumo:
Optical chemical sensors with detection in the near and mid infrared region are reviewed. Fundamental concepts of infrared spectroscopy and optical chemical sensors are briefly described, before presenting some aspects on optical chemical sensors, such as synthesis of NIR and IR reagents, preparation of new materials as well as application in determinations of species of biological, industrial and environmental importance.
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
OBJECTIVE: To characterize the behavior of premature newborns in the first year of chronological age. METHODS: This is a cross-sectional descriptive study, bound to a longitudinal study titled: Comparison of visual behavior on the first quarter of year of life of premature nursling born at two maternities of Recife/PE. The sample was composed by 52 premature newborns selected from June, 2007 to June, 2008 from the Maternity of the Federal University of Pernambuco (UFPE). Biological, socioeconomic and demographic data was collected through medical records and interviews with progeny. Newborns were evaluated by the Assessment Guide of Visual Ability in Infants. RESULTS: Most of the newborns were male at a gestational period between 33 weeks and 36 weeks and 6 days, showed a good visual behavior development for the age researched, and most of the families showed good socioeconomical and demographic profile. Besides, it was possible to detect ocular signs in 19% of sample, that were referred to an Ophthalmology Service. CONCLUSION: This study results point out the method like an important key in the early detection and visual screening for premature nursling since the first month of life and it led us to believe that clinical view for occupational therapy intervention must be focused not only on biological risks but also at the influence environment in newborn performance.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
In Brazil, the Laurencia complex is represented by twenty taxa: Laurencia s.s. with twelve species, Palisada with four species (including Chondrophycus furcatus now that the proposal of its transference to Palisada is in process), and Osmundea and Yuzurua with two species each. The majority of the Brazilian species of the Laurencia complex have been phylogenetically analyzed by 54 rbcL sequences, including five other Rhodomelacean species as outgroups. The analysis showed that the Laurencia complex is monophyletic with high posterior probability value. The complex was separated into five clades, corresponding to the genera: Chondrophycus, Laurencia, Osmundea, Palisada, and Yuzurua. A bibliographical survey of the terpenoids produced by Brazilian species showed that only six species of Laurencia and five of Palisada (including C. furcatcus) have been submitted to chemical analysis with 48 terpenoids (47 sesquiterpenes and one triterpene) isolated. No diterpenes were found. Of the total, 23 sesquiterpenes belong to the bisabolane class and eighteen to the chamigrene type, whose biochemical precursor is bisabolane, two are derived from lauranes and four are triquinols. Despite the considerable number of known terpenes and their ecological and pharmacological importance, few experimental biological studies have been performed. In this review, only bioactivities related to human health were considered.
Resumo:
Saving our science from ourselves: the plight of biological classification. Biological classification ( nomenclature, taxonomy, and systematics) is being sold short. The desire for new technologies, faster and cheaper taxonomic descriptions, identifications, and revisions is symptomatic of a lack of appreciation and understanding of classification. The problem of gadget-driven science, a lack of best practice and the inability to accept classification as a descriptive and empirical science are discussed. The worst cases scenario is a future in which classifications are purely artificial and uninformative.
Resumo:
Pera glabrata (Schott) Baill. was selected for this study after showing a preliminary positive result in a screening of Atlantic Forest plant species in the search for acetylcholinesterase inhibitors and antifungal compounds. The bioassays were conducted with crude ethanol extract of the leaves using direct bioautography method for acetylcholinesterase and antifungal activities. This extract was partitioned with hexane, chloroform and ethyl acetate solvents. The active chloroform fraction was submitted to silica gel chromatography column affording 12 groups. Caffeine, an alkaloid, which showed detection limits of 0.1 and 1.0 µg for anticholinesterasic and antifungal activities, respectively, was isolated from group nine. After microplate analyses, only groups four, nine, 10, 11 and 12 showed acetylcholinesterase inhibitory activity of 40% or higher. The group 12 was purified by preparative layer chromatography affording four sub-fractions. Two sub-fractions from this group were analyzed by gas chromatography-mass spectrometry and gas chromatography-flame ionization detector. The first sub-fraction showed anticholinesterasic activity and contained two major compounds: 9-hydroxy-4-megastigmen-3-one (84%) and caffeine (6%). The second sub-fraction presented five major compounds identified as 9-hydroxy-4-megastigmen-3-one, isololiolide, (-) loliolide, palmitic acid and lupeol and did not show activity.
Resumo:
The effect of S,S-ethylenediaminedisuccinic acid (edds) on the quenching of metal-catalyzed (metal = Mn, Fe, Co, Ni, Cu, Zn) oxidation of ascorbic acid was tested in vitro via oxidation of the fluorescent probe 1,2,3-dihydrorhodamine dihydrochloride. The pro-oxidant activity of iron was not fully suppressed, even at a four-fold molar excess of the ligand. The effect of serum on the toxicity to peripheral blood mononuclear cells (PBMC) and K562 cells was investigated. The cytotoxic effect of Fe-edds was abrogated in the presence of Trolox or serum proteins. The probable pathways of cell toxicity were investigated through blocking of the monocarboxylate transporters (MCT) in association with cell cycle studies by flow cytometry. Cells treated with metal complexes and alpha-cyano-4-hydroxycinnamic acid, a known MCT inhibitor, showed recovery of viability, suggesting that MCT proteins may be involved in the internalization of metal-edds complexes. The free acid induced cell cycle arrest in G0/G1 (PBMC) and S (K562) phases, suggesting direct DNA damage or interference in DNA replication.
Resumo:
The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.
Resumo:
The heterometal alkoxide [FeCl{Ti2(OPr i)9}] (1) was employed as a single source precursor for the preparation of Fe/Ti oxides under inert atmosphere. Three different synthetic procedures were adopted in the processing of 1, either employing aqueous HNO3 or HCl solutions, or in the absence of mineral acids. Products were characterised by powder X-ray diffractometry, scanning electron microscopy combined with energy dispersive X-ray spectroscopy (SEM/EDS) and Raman, electron paramagnetic resonance (EPR) and Mössbauer spectroscopies. Oxide products contained titanium(IV) and either iron(III) or iron(II), depending on reaction conditions and thermal treatment temperatures. An interesting iron(III)→iron(II) reduction was observed at 1000 ºC in the HNO3-containing system, leading to the detection of ilmenite (FeTiO3). SEM/EDS studies revealed a highly heterogeneous metal distribution in all products, possibly related to the presence of a significant content of carbon and of structural defects (oxygen vacancies) in the solids.