957 resultados para specific needs


Relevância:

30.00% 30.00%

Publicador:

Resumo:

To address a significant gap in the workplace coaching literature, we provide an up-to-date, comprehensive review of the literature in order to inform researchers, practitioners and organizations of the current state of play in workplace coaching research. In our review, we apply a systematic assessment of methodological rigour of the extant workplace coaching literature in order to gain insights into the link between rigour and research outcomes. Our review is fully inclusive and therefore includes both quantitative and qualitative studies of workplace coaching including coaching provided by supervisors. We explore the potential antecedents, moderators and mediators impacting on coaching outcomes, such as the coachee and coach profile and coaching intervention variables. Informed by our systematic review and methodological assessment, specific recommendations will be made to guide future research in the field of workplace coaching effectiveness and theoretical development.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Primary objective: To examine emotional coping and support needs in children of persons with acquired brain injury, with a view to understanding what interventions would be helpful for these children. Design: The study was qualitative, using a thematic analysis approach. Methods and procedure: Six children between 9 and 18 years of age, six parents (three with ABI), and three support workers were interviewed either at home or at a support centre, using a semi-structured interview guide. Results: Children reported using a variety of adaptive and maladaptive emotional coping strategies, but were consistent in expressing a need for credible validation, i.e. sharing experiences with peers. The results are presented under four overarching themes: difficulties faced; emotions experienced; coping strategies; and reported support needs. Conclusions: The results reveal an interaction between the child’s experiences of complex loss that is difficult to acknowledge, emotional distancing between parent and child, and the children’s need for credible validation. All children expressed a desire for talking to peers in a similar situation to themselves, but had not had this opportunity. Interventions should set up such peer interaction to create credible validation for the specific distress suffered by this population.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background The culture of current clinical practice calls for collaboration between therapists and patients, sharing power and responsibility. This paper reports on the findings of a qualitative study of exercise prescription for patients with NSCLBP, taking into account issues such as decision making and how this accords with patient preferences and experiences. Objective To understand the treatment decision making experiences, information and decision support needs of patients with NSCLBP who have been offered exercise as part of their management plan. Design A qualitative study using a philosophical hermeneutic approach. Methods Semi-structured interviews with eight patients (including use of brief patient vignettes) was undertaken to explore their personal experiences of receiving exercise as part of the management of their NSCLBP, and their involvement in decisions regarding their care. Findings The findings provide a detailed insight into patients’ perceptions and experiences of receiving exercise-based management strategies. Four themes were formed from the texts: (1) patients’ expectations and patients’ needs are not synonymous, (2) information is necessary but often not sufficient, (3) not all decisions need to be shared, and (4) wanting to be treated as an individual. Conclusions Shared decision making did not appear to happen in physiotherapy clinical practice, but equally may not be what every patient wants. The overall feeling of the patients was that the therapist was dominant in structuring the interactions, leaving the patients feeling disempowered to question and contribute to the decision making.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: The identification of patients' health needs is pivotal in optimising the quality of health care, increasing patient satisfaction and directing resource allocation. Health needs are complex and not so easily evaluated as health-related quality of life (HRQL), which is becoming increasingly accepted as a means of providing a more global, patient-orientated assessment of the outcome of health care interventions than the simple medical model. The potential of HRQL as a surrogate measure of healthcare needs has not been evaluated. OBJECTIVES AND METHOD: A generic (Short Form-12; SF-12) and a disease-specific questionnaire (Seattle Angina Questionnaire; SAQ) were tested for their potential to predict health needs in patients with acute coronary disease. A wide range of healthcare needs were determined using a questionnaire specifically developed for this purpose. RESULTS: With the exception of information needs, healthcare needs were highly correlated with health-related quality of life. Patients with limited enjoyment of personal interests, weak financial situation, greater dependency on others to access health services, and dissatisfaction with accommodation reported poorer HRQL (SF-12: p < 0.001; SAQ: p < 0.01). Difficulties with mobility, aids to daily living and activities requiring assistance from someone else were strongly associated with both generic and disease-specific questionnaires (SF-12: r = 0.46-0.55, p < 0.01; SAQ: r = 0.53-0.65, p < 0.001). Variables relating to quality of care and health services were more highly correlated with SAQ components (r = 0.33-0.59) than with SF-12 (r = 0.07-0.33). Overall, the disease-specific Seattle Angina Questionnaire was superior to the generic Short Form-12 in detecting healthcare needs in patients with coronary disease. Receiver-operator curves supported the sensitivity of HRQL tools in detecting health needs. CONCLUSION: Healthcare needs are complex and developing suitable questionnaires to measure these is difficult and time-consuming. Without a satisfactory means of measuring these needs, the extent to which disease impacts on health will continue to be underestimated. Further investigation on larger populations is warranted but HRQL tools appear to be a reasonable proxy for healthcare needs, as they identify the majority of needs in patients with coronary disease, an observation not previously reported in this patient group

Relevância:

30.00% 30.00%

Publicador:

Resumo:

BACKGROUND: Improving the quality of health care services requires tailoring facilities to fulfil patients' needs. Satisfying patients' healthcare needs, listening to patients' opinions and building a closer provider-user partnership are central to the NHS. Few published studies have discussed cardiovascular patients' health needs, but they are not comprehensive and fail to explore the contribution of outcome to needs assessment. METHOD: A comprehensive self-administered health needs assessment (HNA) questionnaire was developed for concomitant use with generic (Short Form-12 and EuroQOL) and specific (Seattle Angina Questionnaire) health-related quality of life (HRQL) instruments on 242 patients admitted to the Acute Cardiac Unit, Nottingham. RESULTS: 38% reported difficulty accessing health facilities, 56% due to transport and 32% required a travelling companion. Mean HRQOL scores were lower in those living alone (P < 0.05) or who reported unsatisfactory accommodation. Dissatisfaction with transport affected patients' ease of access to healthcare facilities (P < 0.001). Younger patients (<65 y) were more likely to be socially isolated (P = 0.01). Women and patients with chronic disease were more likely to be concerned about housework (P < 0.05). Over 65 s (p < 0.05) of higher social classes (p < 0.01) and greater physical needs (p < 0.001) had more social needs, correlating moderately (0.32 < r < 0.63) with all HRQL domains except SAQ-AS. Several HRQL components were highly correlated with the HNA physical score (p < 0.001). CONCLUSIONS: Patients wanted more social (suitable accommodation, companionship, social visits) and physical (help aids, access to healthcare services, house work) support. The construct validity and intra-class reliability of the HNA tool were confirmed. Our results indicate a gap between patients' health needs and available services, highlighting potential areas for improvement in the quality of services

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Numéro spécial: Translational Nanomedicine

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The degree of delegating authority to non-managerial and non-supervisory workers substantially varies across countries and industries. By examining worker-level data from 14 countries, I empirically explain this variation by region-specific social capital that proxies workers' degree of self-centeredness and the industry-specific need for coordination. The empirical results of this study confirm the theoretical predictions by Alonso et al. (2008) for the first time: the negative association between coordination needs and decentralization is mitigated in regions with lower self-centeredness of workers. In particular, when self-centeredness of workers (respectively, need for coordination) is very low, the degree of delegation is always high regardless of the level of the need for coordination (self-centeredness of workers). Positive associations between delegation and its benefits, including job satisfaction, wages (proxy for higher productivity), and skill upgrading of workers, are also found. These results imply that people's degree of self-centeredness affects a country's economic development patterns by changing the degree of decentralization and its benefits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fear of Missing Out (FoMO) is a pervasive apprehension that others might be having rewarding experiences from which one is absent. Consequently, individuals experiencing FoMO wish to stay constantly in contact with what others are doing and engage with social networking sites for this purpose. In recent times, FoMO has received increased attention from psychological research, as a minority of users experiencing high levels of FoMO - particularly young people - might develop a problematic social networking site use, defined as the maladaptive and excessive use of social networking sites, resulting in symptoms associated with other addictions. According to the theoretical framework of the Interaction of Person-Affect-Cognition- Execution (I-PACE) model, FoMO and certain motives for use may foster problematic use in individuals who display unmet psychosocial needs. However, to date, the I-PACE model has only conceptualized the general higher-order mechanisms related to the development of problematic use. Consistently, the overall purpose of this dissertation was to deepen the understanding of the mediating role of FoMO between specific predisposing variables and problematic social networking sites use. Adopting a psychological approach, two empirical and exploratory cross-sectional studies, conceived as independent research, were conducted through path analysis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The chemical industries worldwide are passing through a very particular moment of re-adaptation due to the implementation of an European regulation called, Registration, Evaluation, Authorization and Restriction of Chemicals (REACH). In Brazil, the Brazilian Chemical Industry needs urgently a specific guide of chemical products stability. The main purpose of this work is to present a proposal of a guide of stability for chemical products based on the reference guides of the International Conference on Harmonization (ICH). Thus, this work proposes an innovation in terms of methodology which will be useful for shelf life definition purpose for chemical industry products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.