Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparação entre o dano muscular de flexores do cotovelo e extensores do joelho em idosos= : Muscle damage comparison between elbow flexors and knee extensors in older adults

Universidade Estadual de Campinas . Faculdade de Educação Física

Large apical periodontitis healing following root canal dressing with calcium hydroxide: a case report

PURPOSE: The objective of this paper is to report the clinical case of a patient who presented a chronic apical periodontitis, arising from internal inflammatory resorption followed by pulp necrosis, and a long-term success of a root canal therapy using calcium hydroxide as root canal dressing. CASE DESCRIPTION: A 20-year-old male patient presented for routine dental treatment. By radiographic examination we noted an extensive radioluscent area, laterally to the permanent maxillary right lateral incisor, with possibility of communication with the lateral periodontium, suggestive of a chronic apical periodontitis. Due to external root resorption detection, we used a calcium hydroxide root canal dressing, changed every 15 days, for a period of 2 months. Root canal filling was performed using gutta-percha cones by lateral condensation technique Radiographic follow up held after 19 years of treatment indicated a periodontium in conditions of normality, with the presence of lamina dura. CONCLUSION: Calcium hydroxide is a suitable material to be used as root canal dressing in teeth with apical periodontitis. Long-term evaluation demonstrated the satisfactory clinical outcome following root canal treatment.

A quantitative and qualitative evaluation of reports of clinical trials published in six Brazilian dental journals indexed in the Scientific Electronic Library Online (SciELO)

INTRODUCTION: Open access publishing is becoming increasingly popular within the biomedical sciences. SciELO, the Scientific Electronic Library Online, is a digital library covering a selected collection of Brazilian scientific journals many of which provide open access to full-text articles.This library includes a number of dental journals some of which may include reports of clinical trials in English, Portuguese and/or Spanish. Thus, SciELO could play an important role as a source of evidence for dental healthcare interventions especially if it yields a sizeable number of high quality reports. OBJECTIVE: The aim of this study was to identify reports of clinical trials by handsearching of dental journals that are accessible through SciELO, and to assess the overall quality of these reports. MATERIAL AND METHODS: Electronic versions of six Brazilian dental Journals indexed in SciELO were handsearched at www.scielo.br in September 2008. Reports of clinical trials were identified and classified as controlled clinical trials (CCTs - prospective, experimental studies comparing 2 or more healthcare interventions in human beings) or randomized controlled trials (RCTs - a random allocation method is clearly reported), according to Cochrane eligibility criteria. CRITERIA TO ASSESS METHODOLOGICAL QUALITY INCLUDED: method of randomization, concealment of treatment allocation, blinded outcome assessment, handling of withdrawals and losses and whether an intention-to-treat analysis had been carried out. RESULTS: The search retrieved 33 CCTs and 43 RCTs. A majority of the reports provided no description of either the method of randomization (75.3%) or concealment of the allocation sequence (84.2%). Participants and outcome assessors were reported as blinded in only 31.2% of the reports. Withdrawals and losses were only clearly described in 6.5% of the reports and none mentioned an intention-to-treat analysis or any similar procedure. CONCLUSIONS: The results of this study indicate that a substantial number of reports of trials and systematic reviews are available in the dental journals listed in SciELO, and that these could provide valuable evidence for clinical decision making. However, it is clear that the quality of a number of these reports is of some concern and that improvement in the conduct and reporting of these trials could be achieved if authors adhered to internationally accepted guidelines, e.g. the CONSORT statement.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Melatonin in maturation media fails to improve oocyte maturation, embryo development rates and DNA damage of bovine embryos

Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Evaluation of DNA extraction protocols for Brucella abortus pcr detection in aborted fetuses or calves born from cows experimentally infected with strain 2308

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

A closer look at multiple-clone Plasmodium vivax infections: detection methods, prevalence and consequences

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.

Pre-processing for noise detection in gene expression classification data

Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.

Visual contrast sensitivity in tonic-clonic epileptic patients

We measured the effects of epilepsy on visual contrast sensitivity to linear and vertical sine-wave gratings. Sixteen female adults, aged 21 to 50 years, comprised the sample in this study, including eight adults with generalized tonic-clonic seizure-type epilepsy and eight age-matched controls without epilepsy. Contrast threshold was measured using a temporal two-alternative forced-choice binocular psychophysical method at a distance of 150 cm from the stimuli, with a mean luminance of 40.1 cd/m². A one-way analysis of variance (ANOVA) applied to the linear contrast threshold showed significant differences between groups (F[3,188] = 14.829; p < .05). Adults with epilepsy had higher contrast thresholds (1.45, 1.04, and 1.18 times for frequencies of 0.25, 2.0, and 8.0 cycles per degree of visual angle, respectively). The Tukey Honestly Significant Difference post hoc test showed significant differences (p < .05) for all of the tested spatial frequencies. The largest difference between groups was in the lowest spatial frequency. Therefore, epilepsy may cause more damage to the neural pathways that process low spatial frequencies. However, epilepsy probably alters both the magnocellular visual pathway, which processes low spatial frequencies, and the parvocellular visual pathway, which processes high spatial frequencies. The experimental group had lower visual contrast sensitivity to all tested spatial frequencies.

Development of instrumentation for amperometric and coulometric detection using ultramicroelectrodes

In this work it is presented the development of a simple, portable and inexpensive instrumentation for amperometric and coulometric detection in different analytical instrumentation systems utilizing ultramicroelectrodes. The software, developed in LabVIEW 7.1TM, is capable to carry out three main detection techniques (amperometric, pulsed amperometric and coulometric detection) and a voltammetric technique (cyclic voltammetry). The instrumentation was successfully evaluated using the following systems: cyclic voltammograms of metallic electrodes in alkaline solutions, flow electrochemical detection of glucose and glycine and direct determination of herbicide glyphosate (electrochemical detection coupled to HPLC).

Determination of picloram in waters by sequential injection chromatography with UV detection

This paper describes a sequential injection chromatography procedure for determination of picloram in waters exploring the low backpressure of a 2.5 cm long monolithic C18 column. Separation of the analyte from the matrix was achieved in less than 60 s using a mobile phase composed by 20:80 (v v-1) acetonitrile:5.0 mmol L-1 H3PO4 and flow rate of 30 μL s-1. Detection was made at 223 nm with a 40 mm optical path length cell. The limits of detection and quantification were 33 and 137 μg L-1, respectively. The proposed method is sensitive enough to monitor the maximum concentration level for picloram in drinking water (500 μg L-1). The sampling frequency is 60 analyses per hour, consuming only 300 μL of acetonitrile per analysis. The proposed methodology was applied to spiked river water samples and no statistically significant differences were observed in comparison to a conventional HPLC-UV method.