Estudo da capacidade de complexação e sua relação com algumas variáveis ambientais em cinco represas do Rio Tietê/Brasil

The copper and cadmium complexation properties in natural sediment suspensions of reservoirs of the Tietê River were studied using the solid membrane copper and cadmium ion-selective electrodes. The complexation and the average conditional stability constants were determined under equilibrium conditions at pH=6.00 ± 0.05 in a medium of 1.0 mol L-1 sodium nitrate, using the Scatchard method. The copper and cadmium electrodes presented Nernstian behavior from 1x10-6 to 1x10-3 mol L-1 of total metal concentration. Scatchard graphs suggest two classes of binding sites for both metals. A multivariate study was done to correlate the reservoirs and the variables: complexation properties, size, total organic carbon, volatile acid sulfide, E II and pH.

Efeito das interações hiperconjugativas na constante de acoplamento ¹J CH da hexametilenotetramina e do adamantano: estudo teórico e experimental

The objective of this work was to determine the influence of hyperconjugative interactions on the ¹J CH coupling constant for hexamethylenetetramine (1) and adamantane (2). For this end, theoretical and experimental ¹J CH were obtained and hyperconjugative interactions were investigated using NBO. It was observed, theoretically and experimentally, that ¹J CH in 1 is 20 Hz larger than in 2, mainly due to the nN®s*C-H hyperconjugative interaction. This interaction occurs only in 1, with an energy of 9.30 kcal mol-1. It increases the s-character of the carbon atom in the C-H bond and the occupancy of the sigma*C-H orbital in (1).

Síntese e estudo de ortossilicatos de zinco luminescentes com aplicação da técnica sol-gel

Usually, the concepts of the Sol-Gel technique are not applied in experimental chemistry courses. This work presents a feasible experiment for chemistry instruction, which involves the synthesis of luminescent materials - Zn2SiO4, with and without Mn2+ as a dopant - by the Sol-Gel technique. The obtained materials were analyzed by scanning electron microscopy, X-Ray diffraction, IR spectroscopy and luminescence measures by UV-vis spectroscopy. The results allow the students to confirm the luminescent properties of the zinc orthosilicate luminophores as well as the structural features expected from literature data.

Estudo por espectroscopia micro-Raman dos mecanismos de separação de fase em vidros fosfatos de metais de transição

Glass-ceramics are prepared by controlled separation of crystal phases in glasses, leading to uniform and dense grain structures. On the other hand, chemical leaching of soluble crystal phases yields porous glass-ceramics with important applications. Here, glass/ceramic interfaces of niobo-, vanado- and titano-phosphate glasses were studied by micro-Raman spectroscopy, whose spatial resolution revealed the multiphase structures. Phase-separation mechanisms were also determined by this technique, revealing that interface composition remained unchanged as the crystallization front advanced for niobo- and vanadophosphate glasses (interface-controlled crystallization). For titanophosphate glasses, phase composition changed continuously with time up to the equilibrium composition, indicating a spinodal-type phase separation.

Aplicações de cromatografia líquida de alta eficiência para o estudo de poluentes orgânicos emergentes

Emerging organic pollutants (EOP) include many environmental contaminants based on commercial products such as pharmaceuticals, personal care products, detergents, gasoline, polymers, etc. EOP may be candidates for future regulation as they offer potential risk to environmental and human health due to their continual entrance into the environment and to the fact that even the most modern wastewater treatment plants are not able to totally transform / remove these compounds. High performance liquid chromatography is recommended to separate emerging organic pollutants with characteristics of high polarity and low volatility, especially pharmaceuticals, from environmental matrices.

Estudo químico de Sinningia allagophylla guiado por testes de atividade antiproliferativa

Activity guided fractionation of Sinningia allagophylla (Mart.) Wiehler ethanolic extract yielded a new benzochromene 8-methoxylapachenol, besides seven known compounds: lapachenol, sitosteryl oleate, sitosteryl linoleate, stigmasteryl oleate, stigmasteryl linoleate, dunniol and tectoquinone. Extract, fractions, and compounds lapachenol, 8-methoxylapachenol, and dunniol were tested in vitro against human cancer cell lines U251 (glioma, CNS), MCF-7 (breast), NCI-ADR/RES (drug-resistant ovarian), 786-0 (kidney), NCI-H460 (lung, no small cells), PC-3 (prostate), OVCAR-3 (ovarian), HT-29 (colon), K562 (leukemia) and against VERO, a normal cell line. The most active compound was dunniol, which inhibited the growth of U251, MCF-7, NCI-ADR/RES, OVCAR-3 and K562 cell lines.

Saúde dos adolescentes: um estudo de base populacional em Campinas, São Paulo, Brasil

We estimated the prevalence of chronic diseases and other health problems reported by adolescents in relation to social and demographic variables and nutritional status. This cross-sectional population-based survey analyzed data from the Health Survey in Campinas, São Paulo State, Brazil, 2008. We used descriptive statistics and associations between variables with the chisquare test. Prevalence of chronic diseases among adolescents was 19.17%, with asthma showing the highest prevalence (7.59%), followed by heart disease (1.96%), hypertension (1.07%), and diabetes 0.21%. Prevalence rates were 61.53% for health problems, 40.39% for allergy, and 24.83% for frequent headache or migraine. After multivariate analysis using Poisson regression, the factors associated with chronic disease were age 15 to 19 years (PR = 1.38), not attending school (PR = 1.46), having children (PR = 1.84), and obesity (PR = 1.54). Female gender (PR = 1.12) was statistically associated with health problems. The study illustrates that adolescence is a life stage in which chronic disease and health problems can occur.

Estudo inicial da degradação in vivo de poli(L-co-D,L ácido lático), sintetizado em laboratório, aplicado como prótese tibial em coelhos

The copolymer poly (L-co-D,L lactic acid), PLDLA, has gained prominence in the field of temporary prostheses due to the fact that their time of degradation is quite compatible with the requirement in the case of osseous fracture. In this work the in vivo degradation of devices from copolymer, as a system of plates and screws, used in fixation of the tibia of rabbits was studied. The devices were implanted in 15 adult rabbits, albinos, New Zealand race, and they were used as control devices of alloys of titanium (Ti-6Al-4V/ V grade). The use of copolymers, synthesized in the laboratory, was tested in the repair of fracture in rabbits'tibias, being assessed in the following times: 2 weeks, 2 months and 3 months. Morphological analysis of tissue surrounding the plate and screw system, for 2 weeks of implantation, showed the presence of osteoblasts, indicating a pre bone formation. After 2 months there was new bone formation in the region in contact with the polymer. This bone growth occurred simultaneously with the process of PLDLA degradation, invading the region where there was polymer and after 3 months there was an intense degradation of the copolymer and hence greater tissue invasion compared to 2 months which characterized bone formation in a region where the polymer degraded. The in vivo degradation study of the devices for PLDLA by means of histological evaluations during the period of consolidation of the fracture showed the efficiency of plate and screw system, and it was possible to check formation of bone tissue at the implantation site, without the presence of inflammatory reaction

Efeito cariostático de restaurações adesivas em superfícies radiculares: estudo in vitro

Dental materials that release fluoride have been shown to be effective in caries inhibition around restorations. Adhesive materials would also be effective in caries inhibition by sealing and protecting cavity margins from acidic demineralization. This in vitro study tested the hypothesis that composite restorations with a dentin adhesive system have a caries preventive effect similar to that of an adhesive material with fluoride - glass-ionomer cement - on root surfaces. Twenty roots from extracted sound third molars were embedded in polystyrene resin and ground flat. Standardized cavities were prepared in leveled root surfaces and randomly restored with (a) Chelon-Fil (Espe) or (b) Z100/SingleBond (3M). Baseline indentations were measured at 100, 200 and 300 mum from the occlusal margins of each restoration and the surface microhardness values were obtained using a Knoop diamond indenter. A 2.0 mm wide margin around the restorations was submitted to a pH-cycling model, at 37ºC. After that, surface microhardness was measured again, as it was before. The differences between baseline and final surface microhardness were considered for statistical analysis. The median values of differences were (a): -3.8; -0.3; -1.0; and (b): 3.3; 2.5; 1.7, for the distances of 100, 200 and 300 mum, respectively. The Kruskal-Wallis test did not show statistically significant difference between 100, 200 and 300 mum distances in each tested group. There was no difference between the studied materials at the distances of 200 and 300 mum. Chelon-Fil was statistically different from Z100/SingleBond, at 100 mum (p<0.05). Under the studied conditions, the glass-ionomer cement had a higher caries preventive effect than the composite/dentin adhesive restorations.

Estudo comparativo dos métodos de estimativa da idade óssea de Greulich & Pyle e Tanner & Whitehouse

The purpose of this study was to verify whether the Greulich & Pyle (GP), Greulich & Pyle Visual (GPV) and Tanner & Whitehouse (TW) methods for estimating skeletal age could be applied in the Brazilian population, and which of these three methods could be considered more reliable when compared with the chronological age of the individuals. This study was based on one hundred and sixty volunteers (80 females and 80 males) with ages between 6 years and 10 months and 14 years and 9 months. The results showed that for the GP method, the correlations with chronological age were 0.95 for males and 0.97 for females. For the GPV method, the correlations were 0.96 and 0.97, respectively and for TW, 0.96 and 0.97. The results showed that the Greulich & Pyle, Greulich & Pyle Visual and Tanner & Whitehouse methods presented high correlation values when compared with the chronological age of the individuals. Corrective factors were established to make these methods applicable to the Brazilian population.

Efeito de baixas doses de radiação X em feridas suturadas e não suturadas - estudo experimental em ratos

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Estudo dos efeitos de temporada de treinamento físico sobre a Performance de uma equipe de handebol feminino sub-21

Handball is a sport that demands endurance associated with fast and powerful actions such as jumps, blocks, sprints and throws. The aim of this study was to evaluate the effects of a 38-week systematic physical training applied to a women's under 21 handball team on upper and lower limb power, 30m sprints speed and endurance. The periodization applied was an adaptation of the Verkhoshansky theory, and aimed at two performance peaks during the season with six data collections. The median and range values for three kg medicine ball throwing was: 2.98m (2.15-3.50); 2.84m (2.43-3.20); 2.90m (2.60-3.38); 3.10 (2.83-3.81); 2.84 (2.55-3.57) and 3.34 (2.93-3.83). Regarding the three-pass running test: 5.60m (4.93-6.58); 5.37m (5.04-6.38); 5.36m (4.93-6.12); 5.65m (4.80-6.78); 5.63m (5.00-6.40) and 5.83m (5.14-6.05). Regarding the 30-m sprint test: 5.8m/s (5.45-6.44); 6,64 m/s (6,24-7,09); 5.65m/s (5.17-5.95); (there was not IV moment for this test); 6.19 m/s (5.57-6.26) and 5.83 (5.14-6.05).Regarding the 30-m sprint endurance test until 10% decrease: 4 sprints (4-6); 5 sprints (4-9); 4,5 sprints (4-16); (there was not IV moment for this test); 6 sprints (4-12) and 5 sprints (4-5). Significant differences (p<0.05) were observed in three kg medicine ball throwing and three-pass running tests at least in one of the performance peak planned, with no significant differences in 30-m sprint speed or endurance tests. The applied physical training was efficient at improving the specific physical fitness in the performance peaks, as well as giving support for better physical training adjustment for the upcoming season.

ESTUDO DA PREPARAÇÃO DOS EXTRATOS DE PRÓPOLIS E SUAS APLICAÇÕES

Ethanolic extracts from propolis were performed by using lhe water and vaflous coneentrations of etanol as solvent. The extracts were investigated by measurement of absorption spectruin with Uv-spectrophotometer (UV-scanning), reversed phase-high performance thin-layer chromatography, Reversed phase-HPLC. Maximum absorption of ali extracts was 290 nm, resembling flavonoid compounds and 80% ethanolic extract showed highest absorption at 290 nm. The most isosakuranetin, quercefin, and kaempferol were extracted from mixtures of propolis and 60% etanol, whereas 70% etanol extracted te most pinocembrin and sakuranetin, but 80% etanol extracted more kaempferide, acacetin, and isorhamnetin from propolis. The 60 to 80% ethanolic extracts ofpropolis inhibited highly to microbial growth and 70 and 80% ethanolic extracts showed lhe greatest antioxidant activity and 80% ethanolic extract inhibited highly to hyaluronidase activity.

Féculas fermentadas na fabricação de biscoitos: estudo de fontes alternativas

The fermented cassava starch has been used as raw material for many products of the Brazilian culinary mainly in the biscuit manufacturing. Starch of arrowroot, english potato, baroa-potato and cassava were extracted and fermented in order to investigate other fermented starch sources for manufacturing biscuits. The fermented starch showed characteristics similar to those of commercial fermented cassava starch. The biscuits manufactured from the fermented starch of english potato didn?t expand and was very hard and the biscuits manufactured from the fermented starch of arrowroot and of baroa-potato were approved by the consumers and can be used in the biscuit manufacturing the same way as the fermented cassava starch.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.