Alteração dimensional linear de resinas para bases de próteses polimerizadas com microondas

This study examined the influence of three polymerization cycles (1: heat cure - long cycle; 2: heat cure - short cycle; and 3: microwave activation) on the linear dimensions of three denture base resins, immediately after deflasking, and 30 days after storage in distilled water at 37± 2ºC. The acrylic resins used were: Clássico, Lucitone 550 and Acron MC. The first two resins were submitted to all three polymerization cycles, and the Acron MC resin was cured by microwave activation only. The samples had three marks, and dimensions of 65 mm in length, 10 mm in width and 3 mm in thickness. Twenty-one test specimens were fabricated for each combination of resin and cure cycle, and they were submitted to three linear dimensional evaluations for two positions (A and B). The changes were evaluated using a microscope. The results indicated that all acrylic resins, regardless of the cure cycle, showed increased linear dimension after 30 days of storage in water. The composition of the acrylic resin affected the results more than the cure cycles, and the conventional acrylic resin (Lucitone 550 and Clássico) cured by microwave activation presented similar results when compared with the resin specific for microwave activation.

Rugosidade e pigmentação superficial de materiais ionoméricos

The aim of this study was to compare two methods of surface roughness analysis, perfilometry and spectrophotometry, applied to the surface of ionomeric materials (Chelon Fil, Vitremer and Dyract), submitted to different surface finishing treatments. For the perfilometric analysis, sixty specimens of each material were made and randomly separated into three experimental groups. The average surface roughness (Ra, mm) was measured on each specimen by a surface perfilometer (Mitutoyo Surftest 211). The spectrophotometric analysis consisted in quantifying the dye impregnated in the samples. The dyes used were 0.5% fuchsin and 0.5% erythrosin. Data were submitted to variance analysis (ANOVA) and t-Student test at a 0.05 significance level. There was no linear correlation between average roughness and superficial deposition of dye. Perfilometric analysis revealed that 12- and 30-bladed carbide burs caused the roughest surface of Chelon Fil, followed by Sof-Lex discs and mylar band. There were no significant differences between the specimens submitted to finishing and polishing with Sof-Lex discs and the control group (mylar band) for Vitremer, nevertheless, the highest Ra values were obtained when 12- and 30-bladed burs were used. For Dyract, there was no significant difference between the three treatments. The mean values of superficial deposition of dye for Chelon Fil, Vitremer and Dyract were: 1.7261, 1.4759, 1.3318, respectively. There were no significant differences between the restorative materials when different finishing and polishing systems were used.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Enunciações afetadas : relações possíveis entre homofobia e esporte

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposição e avaliação de um modelo de representação dos membros superiores e escapula durante a marcha humana

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para descrição da orientação do corpo humano

Universidade Estadual de Campinas. Faculdade de Educação Física

A aula de educação fisica como reprodutora de estereotipos de genero a luz da experiencia no Colegio "Inem Santiago Perez" : Santa-Fé de Bogota-Colombia

Universidade Estadual de Campinas . Faculdade de Educação Física

O corpo feminino no encontro com a antiginastica

Universidade Estadual de Campinas . Faculdade de Educação Física

Homo-motor, ciborgues e... aha! pessoas : da revolução industrial a revolução da informação

Universidade Estadual de Campinas . Faculdade de Educação Física

O corpo e seus textos : o estetico, o politico e o pedagogico na dança

Universidade Estadual de Campinas. Faculdade de Educação Física

As roupas esportivas em Revista na cidade de Belo Horizonte (1929-1950) : moldes, recortes e costuras

Universidade Estadual de Campinas. Faculdade de Educação Física

Marcas da religião evangelica na educação do corpo feminino : implicações para a educação fisica escolar

Universidade Estadual de Campinas . Faculdade de Educação Física

Proposta de avaliação da simetria e transferencia de peso e a relação dessa condição com a atividade funcional do hemiplegico

Universidade Estadual de Campinas . Faculdade de Educação Física

Risco, corpo e socialidade no voo livre

Universidade Estadual de Campinas . Faculdade de Educação Física

Transformação corporal e representação social na adolescencia

Universidade Estadual de Campinas . Faculdade de Educação Física