STUDIES ON THE RELATIONSHIP BETWEEN THE PATHOGENICITY OF PARACOCCIDIOIDES-BRASILIENSIS IN MICE AND ITS GROWTH-RATE UNDER DIFFERENT OXYGEN ATMOSPHERES

We performed comparative studies of the pathogenicity of six strains of Paracoccidioides brasiliensis (Bt-9, Bt-4, Pb-9, Pb-18, Bt-7 and B-1183) for young adult male ddY mice and growth rate of each strain under different oxygen atmospheres (aerobic, micro-aerobic and anaerobic atmospheres) at 37-degrees-C. 10(6) units of yeast cells were intravenously injected into each mouse. The pathogenicity of each isolate was determined by a scoring system based on organ culture and histopathological findings. The growth rates under different oxygen atmospheres were determined by a scoring system in which 300 fungal units per strain were counted. The strain Bt-9 showed the greatest pathogenicity, followed by Bt-4. Pb-9 and Pb-18 had on intermediate rank of pathogenicity. Bt-7 and B-1183 were the least pathogenic of the strains tested. Except for strain Bt-7 all strains showed an excellent growth under an aerobic atmosphere. Bt-4 and Bt-9 also showed excellent growth under a micro-aerobic atmosphere, followed by Pb-9, whereas the growth of Pb-18, Bt-7 and B-1183 was limited. There was a correlation between the growth rate under a micro-aerobic atmosphere and the pathogenicity of a strain. The growth rate of P. brasiliensis under a micro-aerobic atmosphere strongly correlated to its pathogenicity.

Positron-emission tomography studies of cross-modality inhibition in selective attentional tasks: closing the "mind's eye".

It is a familiar experience that we tend to close our eyes or divert our gaze when concentrating attention on cognitively demanding tasks. We report on the brain activity correlates of directing attention away from potentially competing visual processing and toward processing in another sensory modality. Results are reported from a series of positron-emission tomography studies of the human brain engaged in somatosensory tasks, in both "eyes open" and "eyes closed" conditions. During these tasks, there was a significant decrease in the regional cerebral blood flow in the visual cortex, which occurred irrespective of whether subjects had to close their eyes or were instructed to keep their eyes open. These task-related deactivations of the association areas belonging to the nonrelevant sensory modality were interpreted as being due to decreased metabolic activity. Previous research has clearly demonstrated selective activation of cortical regions involved in attention-demanding modality-specific tasks; however, the other side of this story appears to be one of selective deactivation of unattended areas.

Engineered Nanoparticles And Organic Matter: A Review Of The State-of-the-art.

Growth in the development and production of engineered nanoparticles (ENPs) in recent years has increased the potential for interactions of these nanomaterials with aquatic and terrestrial environments. Carefully designed studies are therefore required in order to understand the fate, transport, stability, and toxicity of nanoparticles. Natural organic matter (NOM), such as the humic substances found in water, sediment, and soil, is one of the substances capable of interacting with ENPs. This review presents the findings of studies of the interaction of ENPs and NOM, and the possible effects on nanoparticle stability and the toxicity of these materials in the environment. In addition, ENPs and NOM are utilized for many different purposes, including the removal of metals and organic compounds from effluents, and the development of new electronic sensors and other devices for the detection of active substances. Discussion is therefore provided of some of the ways in which NOM can be used in the production of nanoparticles. Although there has been an increase in the number of studies in this area, further progress is needed to improve understanding of the dynamic interactions between ENPs and NOM.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Chemical and in vitro study of the potential of 3-(aryl)-2-sulfanylpropenoic acids and their Zn(II) complexes as protective agents against cadmium toxicity

The free H(2)xspa ligands [xspa = pspa, Clpspa, tspa or fspa where p = 3-(phenyl), Clp = 3-(2-chlorophenyl), t = 3-(2-thienyl), f = 3-(2-furyl) and spa = 2-sulfanylpropenoato], their Zn(II) complexes of formula [HQ](2)[Zn(xspa)(2)] (HQ=diisopropylammonium) and the Cd(II) equivalents were prepared and characterized by elemental analysis and by IR, Raman and NMR ((1)H, (13)C) spectroscopy. X-Ray studies of the crystal structures of [HQ](2)[Zn(pspa)(2)], [HQ](2)[Zn(Clpspa)2], [HQ](2)[Zn(tspa)(2)] and [HQ](2)[Zn(fspa)(2)] show that the zinc atom is coordinated to two O atoms and two S atoms of the ligands in a distorted tetrahedral ZnO(2)S(2) environment. In the structures of [HQ](2)[Cd(pspa)(2)] and [HQ](2)[Cd(Clpspa)(2)] the cadmium atom is coordinated to three S atoms and two carboxylato O atoms of the ligands in a distorted trigonal bipyramidal environment. The interchange of ligands between Zn( II) and Cd( II) was studied by (113)Cd NMR spectroscopy. The in vitro protective effect of H(2)xspa and their Zn( II) complexes against Cd toxicity was investigated using the human hepatocarcinoma HepG2 cell line and the pig renal proximal tubule LLC-PK1 cell line. The incorporation of Zn( II) was found to be relevant in the case of H(2)pspa, with an increase observed in the cell viability of the LCC-PK1 cells with respect to the value for the free ligand.

Evaluation of the genotoxic and antigenotoxic effects after acute and subacute treatments with acai pulp (Euterpe oleracea Mart.) on mice using the erythrocytes micronucleus test and the comet assay

Acai, the fruit of a palm native to the Amazonian basin, is widely distributed in northern South America, where it has considerable economic importance. Whereas individual polyphenolics compounds in Acai have been extensively evaluated, studies of the intact fruit and its biological properties are lacking. Therefore, the present study was undertaken to investigate the in vivo genotoxicity of Acai and its possible antigenotoxicity on doxorubicin (DXR)-induced DNA damage. The Acai pulp doses selected were 3.33, 10.0 and 16.67 g/kg b.w. administered by gavage alone or prior to DXR (16 mg/kg b.w.) administered by intraperitoneal injection. Swiss albino mice were distributed in eight groups for acute treatment with acai pulp (24 h) and eight groups for subacute treatment (daily for 14 consecutive days) before euthanasia. The negative control groups were treated in a similar way. The results of chemical analysis suggested the presence of carotenoids, anthocyanins, phenolic. and flavonoids in Acai pulp. The endpoints analyzed were micronucleus induction in bone marrow and peripheral blood cells polychromatic erythrocytes, and DNA damage in peripheral blood, liver and kidney cells assessed using the alkaline (pH > 13) comet assay. There were no statistically significant differences (p > 0.05) between the negative control and the groups treated with the three doses of Acai pulp alone in all endpoints analyzed, demonstrating the absence of genotoxic effects. The protective effects of Acai pulp were observed in both acute and subacute treatments, when administered prior to DXR. In general, subacute treatment provided greater efficiency in protecting against DXR-induced DNA damage in liver and kidney cells. These protective effects can be explained as the result of the phytochemicals present in Acai pulp. These results will be applied to the developmental of food with functional characteristics, as well as to explore the characteristics of Acai as a health promoter. (C) 2009 Elsevier B.V. All rights reserved.

Gender and drought: Experiences of Australian women in the drought of the 1990s

A unique collaborative, sociological study undertaken during 1995-7, explored the social construction of drought as a disaster, looking at farm families in two Australian states: Queensland (beef producers) and New South Wales (sheep/wheat producers). A. decision was made to interview the women and men separately to test our hypothesis that there would be gender issues in any analysis of a disaster, but particularly one which has had so much long-term impact on individuals, families and communities, Such as drought, interviews were conducted with over 100 individuals male and female, We conclude that drought as a disaster is a gendered experience. The paper draws on the narratives of some women involved in the study to identify 'themes of difference' which confirm the necessity to maintain gender as a variable in all studies of the social impacts of disaster.

Persistence and expression of Cotesia congregata polydnavirus in host larvae of the tobacco hornworm, Manduca sexta

The gregarious braconid wasp Cotesia congregata parasitizes host larvae of Manduca sexta, and several other sphingid species. Parasitism induces host immunosuppression due to the disruptive action of the wasp's polydnavirus (PDV) on host blood cells. During the initial stages of parasitism, these cells undergo apoptosis followed by cell clumping, which clears the hemolymph of a large number of cells. In this study, the persistence and expression of Cotesia congregata PDV (CcPDV) were examined using Southern and Nor-them blots, respectively. Digoxygenin-labelled total polydnaviral DNA was used to probe genomic DNA isolated from fat body and brains of hosts with emerged wasps taken 6 days following egress of the parasitoids, and significant cross-hybridization between the host fat body genomic DNA with viral DNA was seen. Thus, the virus persists in the host for the duration of parasitism. even during the post-emergence period, and may even be integrated in the host caterpillar DNA. Viral gene expression was examined using Northern blots and probes to the Cotesia rubecula CrV1 homolog, and the CrV1-like mRNAs were expressed as early as 4 h post-parasitization for at least 72 h and faint hybrization is even seen at the time the wasps eclose. In contrast, in Pieris rapae larvae the CrV1 transcript is expressed only for a brief time, during which time hemocyte function is disrupted. The effect is transitory, and hemocytes regain their normal functions after the parasites emerge as first instars. The genome of CcPDV contains one copy of the CrV1-like homolog as shown on Southern blots of viral genomic DNA. In conjunction with our earlier studies of the PDV-encoded early protein 1, the current work suggests multiple viral transcripts are produced following parasitization of the host. and likely target host hemocytes to induce their apoptosis, thereby preventing encapsulation of the parasitoid's eggs. Whether viral DNAs are integrated in the host's genomic DNA remains to be proven, but our results provide preliminary evidence that viral DNAs are detected in the host's fat body cells examined at the time of wasp ernergence and several days later. (C) 2003 Elsevier Science Ltd. All rights reserved.

Spermatophore and Gonopore Morphology of the Southwestern-Atlantic Hermit Crab Pagurus exilis (Benedict, 1892) (Anomura, Paguridae)

Marcelo A. Scelzo, Marina Z. Fantucci, and Fernando L. Mantelatto (2010) Spermatophore and gonopore morphology of the southwestern-Atlantic hermit crab Pagurus exilis (Benedict, 1892) (Anomura, Paguridae). Zoological Studies 49(3): 421-433. The form and function of the spermatophore have been used as a complementary tool in studies of the reproductive biology and systematics of hermit crabs. In this context, we describe the spermatophore and gonopore morphology of Pagurus exilis. The spermatophores were extracted from the distal part of the vas deferens of specimens collected in Argentina and Brazil. The spermatophores were composed of 3 major regions: a main ampulla (with a sperm capsule inside and an accessory ampulla at the base), a stalk, and a pedestal. Each spermatophore had a distinct dorsolateral suture line around the ampulla, where the rupture occurs to release the sperm. The spermatophore total length was 1.5 times the main ampulla length. The main ampulla was oval and slightly flattened. A triangular accessory ampulla extended from the main ampulla base to the pedestal on 1 side, and contained no to several sperm. The stalk is short and flattened, and as wide as the main ampulla. One to 3 spermatophores were found attached to each pedestal, which was almost oblong in shape. The dimensions of the spermatophore and its component parts were directly influenced by the size of the hermit crab. Gonopores of males were covered by long pappose setae, while female gonopores bore a few short cuspidate setae. Specimens from Brazil and Argentina had the same spermatophore morphology, corroborating the previously observed absence of genetic differences between the both populations. The spermatophore morphology of this species has similarities with the broad general pattern of the Paguridae, being most similar to one of the (at least) 3 patterns of spermatophore morphology described for Pa gurus. http://zoolstud.sinica.edu.tw/Journals/49.3/421.pdf

Autoimmune lymphoproliferative syndrome in a patient with a new minimal deletion in the death domain of the FAS gene

We present a case of autoimmune lymphoproliferative syndrome (ALPS) caused by a previously undescribed minimal deletion in the death domain of the FAS gene. ALPS is an uncommon disease associated with an impaired Fas-mediated apoptosis. The patient presented with a history of splenomegaly since 4 months of age, associated with cervical lymphadenopathy, which improved with oral corticosteroid treatment. Relevant laboratory findings were the presence of anemia, thrombocytopenia, and positive direct and indirect Coombs tests. He was not an offspring of consanguineous parents. Two cervical lymph node biopsies were performed, at 4 years and at 6 years of age. In both lymph nodes, there was marked paracortical expansion by lymphocytes in variable stages of immunoblastic transformation and a very high cell proliferating index. Some clear cells were also present, raising the suspicion of malignant lymphoma. In one of the lymph nodes, there was also a focus rich in large histiocytes with round nuclei and emperipolesis, consistent with focal Rosai-Dorfman disease. Immunostaining showed numerous CD3+ cells, many of which were double-negative (CD4- CD8-) and expressed CD57, especially around the follicles. Molecular studies of the lymph node biopsy showed a point deletion (4-base pair deletion) in exon 9 of the FAS gene (930del TGCT), which results in 3 missense amino acids. (c) 2008 Elsevier Inc. All rights reserved.

Intra and inter-examiner reliability of the subacromial impingement index

The present study aimed to assess the reliability of intra and inter-examiner subacromial impingement index (SII) measures obtained from radiographs. Thirty-six individuals were enrolled and divided into two groups: control group, composed of 18 volunteers in good general health without shoulder problems, and a group of 18 patients with subacromial impingement syndrome (SIS). Radiographic images were taken with the dominant upper limb in neutral rotation, while the volunteers held their arm at 90A degrees of abduction in the frontal plane. The beam of radiation at 30A degrees craniocaudal inclination was used to provide an antero-posterior image view. Three blinded examiners each performed three measurements from the subacromial space (SS) and the anatomical neck of the humerus (NH). The SII was calculated as the ratio of the SS and the NH measures. The mean values of SII were compared using t-tests. The intra-class correlation coefficient (ICC) was used to assess intra- and inter-examiner reliability of the measures. The mean values of SII were greater for the control group (0.12) than for the SIS group (0.08; p = 0.0071). SII measurements showed excellent intra (0.96-0.99) and inter-examiner reliability (0.94) for both the control and SIS group. The results of this study show the potential use of the SII; a greater mean value for the control group compared to the SIS group and excellent reliability for intra- and inter-examiner measurement. Validation studies of the index should be conducted to correlate the index with clinical findings from subacromial impingement syndrome.

Mutations involved in Aicardi-Goutieres syndrome implicate SAMHD1 as regulator of the innate immune response

Aicardi-Goutieres syndrome is a mendelian mimic of congenital infection and also shows overlap with systemic lupus erythematosus at both a clinical and biochemical level. The recent identification of mutations in TREX1 and genes encoding the RNASEH2 complex and studies of the function of TREX1 in DNA metabolism have defined a previously unknown mechanism for the initiation of autoimmunity by interferon-stimulatory nucleic acid. Here we describe mutations in SAMHD1 as the cause of AGS at the AGS5 locus and present data to show that SAMHD1 may act as a negative regulator of the cell-intrinsic antiviral response.

Identification of the regulatory subunit of Arabidopsis thaliana acetohydroxyacid synthase and reconstitution with its catalytic subunit

Acetohydroxyacid synthase (EC 4.1.3.18; AHAS) catalyzes the initial step in the formation of the branched-chain amino acids. The enzyme from most bacteria is composed of a catalytic subunit, and a smaller regulatory subunit that is required for full activity and for sensitivity to feedback regulation by valine. A similar arrangement was demonstrated recently for yeast AHAS, and a putative regulatory subunit of tobacco AHAS has also been reported. In this latter case, the enzyme reconstituted from its purified subunits remained insensitive to feedback inhibition, unlike the enzyme extracted from native plant sources. Here we have cloned, expressed in Escherichia coil, and purified the AHAS regulatory subunit of Ambidopsis thaliana. Combining the protein with the purified A. thaliana catalytic subunit results in an activity stimulation that is sensitive to inhibition by valine, leucine, and isoleucine. Moreover, there is a strong synergy between the effects of leucine and valine, which closely mimics the properties of the native enzyme. The regulatory subunit contains a sequence repeat of approximately 180 residues, and we suggest that one repeat binds leucine while the second binds valine or isoleucine. This proposal is supported by reconstitution studies of the individual repeats, which were also cloned, expressed, and purified. The structure and properties of the regulatory subunit are reminiscent of the regulatory domain of threonine deaminase (EC 4.2.1.16), and it is suggested that the two proteins are evolutionarily related.

A comparative study of the radiation resistance of four optically transparent polyimides

A comparative study of the high energy radiation resistance to formation of radicals in two pairs of polymers is reported. In one pair of polymers the phenyl groups containing the imide rings are separated by an ether linkage and in the other pair they are separated by an hexafluoroisopropylidine group. Two of the polymers contained aromatic amine units linked through an ether linkage and the other two polymers contained a trifluoromethyl biphenyl diamine. The polymers were shown to retain a high level of transparency in the visible region following radiolysis to doses as high as 8 Gy. ESR studies of the resistance to radical formation on radiolysis. at 77 K revealed that the polymers containing ether linkages were more stable than their fluorinated analogues, but all were less stable than Kapton (R). (C) 2001 Elsevier Science Ltd. All rights reserved.

The effect of the cleaner fish Labroides dimidiatus on the capsalid monogenean Benedenia lolo parasite of the labrid fish Hemigymnus melapterus

The cleaner fish Labroides dimidiatus affected the pigmented monogenean parasite Benedenia lolo on the fish Hemigymnus melapterus (Labridae) held in aquaria. The effect of cleaner fish varied with the size class of fish; only small fish [a posteriori size class < 11-5 cm standard length (L-S)] exposed to cleaner fish had fewer monogeneans compared with fish not exposed to cleaner fish. The abundance of monogeneans on large fish (a posteriori size class > 11-5 cut L-S) was not affected by cleaner fish. The size-frequency distributions of monogeneans on both size-classes of H. melapterus were affected by cleaner fish. Fish exposed to cleaner fish had fewer large (> 3 mm) and more small (< 1 mm) monogeneans than fish not exposed to cleaner fish, suggesting cleaner fish selectively removed larger monogeneans. This difference was more pronounced on large fish. In the absence of cleaner fish, small fish had almost as many monogeneans as large fish; they also had more small monogeneans than the large fish, suggesting small fish were more vulnerable to infection by monogeneans than larger fish. This suggests that the cleaner fish L. dimidiatus has the potential to control benedeniine monogeneans on captive fish and highlights the importance of taking into account fish size in studies of the effect of cleaner fish on ectoparasites. (C) 2002 The Fisheries Society of the British Isles. Published by Elsevier Science Ltd. All rights reserved.