929 resultados para phlebotomine sand fly larvae


Relevância:

30.00% 30.00%

Publicador:

Resumo:

A new interaction between insects and carnivorous plants is reported from Brazil. Larvae of the predatory flower fly Toxomerus basalis (Diptera: Syrphidae: Syrphinae) have been found scavenging on the sticky leaves of several carnivorous sundew species (Drosera, Droseraceae) in Minas Gerais and São Paulo states, SE Brazil. This syrphid apparently spends its whole larval stage feeding on prey trapped by Drosera leaves. The nature of this plant-animal relationship is discussed, as well as the Drosera species involved, and locations where T. basalis was observed. 180 years after the discovery of this flower fly species, its biology now has been revealed. This is (1) the first record of kleptoparasitism in the Syrphidae, (2) a new larval feeding mode for this family, and (3) the first report of a dipteran that shows a kleptoparasitic relationship with a carnivorous plant with adhesive flypaper traps. The first descriptions of the third instar larva and puparium of T. basalis based on Scanning Electron Microscope analysis are provided.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Organisms from slime moulds to humans carefully regulate their macronutrient intake to optimize a wide range of life history characters including survival, stress resistance, and reproductive success. However, life history characters often differ in their response to nutrition, forcing organisms to make foraging decisions while balancing the trade-offs between these effects. To date, we have a limited understanding of how the nutritional environment shapes the relationship between life history characters and foraging decisions. To gain insight into the problem, we used a geometric framework for nutrition to assess how the protein and carbohydrate content of the larval diet affected key life history traits in the fruit fly, Drosophila melanogaster. In no-choice assays, survival from egg to pupae, female and male body size, and ovariole number - a proxy for female fecundity - were maximized at the highest protein to carbohydrate (P:C) ratio (1.5:1). In contrast, development time was minimized at intermediate P:C ratios, around 1:2. Next, we subjected larvae to two-choice tests to determine how they regulated their protein and carbohydrate intake in relation to these life history traits. Our results show that larvae targeted their consumption to P:C ratios that minimized development time. Finally, we examined whether adult females also chose to lay their eggs in the P:C ratios that minimized developmental time. Using a three-choice assay, we found that adult females preferentially laid their eggs in food P:C ratios that were suboptimal for all larval life history traits. Our results demonstrate that D. melanogaster larvae make foraging decisions that trade-off developmental time with body size, ovariole number, and survival. In addition, adult females make oviposition decisions that do not appear to benefit the larvae. We propose that these decisions may reflect the living nature of the larval nutritional environment in rotting fruit. These studies illustrate the interaction between the nutritional environment, life history traits, and foraging choices in D. melanogaster, and lend insight into the ecology of their foraging decisions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Queensland fruit fly, Bactrocera (Dacus) tryoni (QFF) is arguably the most costly horticultural insect pest in Australia. Despite this, no model is available to describe its population dynamics and aid in its management. This paper describes a cohort-based model of the population dynamics of the Queensland fruit fly. The model is primarily driven by weather variables, and so can be used at any location where appropriate meteorological data are available. In the model, the life cycle is divided into a number of discreet stages to allow physiological processes to be defined as accurately as possible. Eggs develop and hatch into larvae, which develop into pupae, which emerge as either teneral females or males. Both females and males can enter reproductive and over-wintering life stages, and there is a trapped male life stage to allow model predictions to be compared with trap catch data. All development rates are temperature-dependent. Daily mortality rates are temperature-dependent, but may also be influenced by moisture, density of larvae in fruit, fruit suitability, and age. Eggs, larvae and pupae all have constant establishment mortalities, causing a defined proportion of individuals to die upon entering that life stage. Transfer from one immature stage to the next is based on physiological age. In the adult life stages, transfer between stages may require additional and/or alternative functions. Maximum fecundity is 1400 eggs per female per day, and maximum daily oviposition rate is 80 eggs/female per day. The actual number of eggs laid by a female on any given day is restricted by temperature, density of larva in fruit, suitability of fruit for oviposition, and female activity. Activity of reproductive females and males, which affects reproduction and trapping, decreases with rainfall. Trapping of reproductive males is determined by activity, temperature and the proportion of males in the active population. Limitations of the model are discussed. Despite these, the model provides a useful agreement with trap catch data, and allows key areas for future research to be identified. These critical gaps in the current state of knowledge exist despite over 50 years of research on this key pest. By explicitly attempting to model the population dynamics of this pest we have clearly identified the research areas that must be addressed before progress can be made in developing the model into an operational tool for the management of Queensland fruit fly. (C) 2003 Published by Elsevier B.V.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Ocean acidification, as a result of increased atmospheric CO2, has the potential to adversely affect the larval stages of many marine organisms and hence have profound effects on marine ecosystems. This is the first study of its kind to investigate the effects of ocean acidification on the early life-history stages of three echinoderms species, two asteroids and one irregular echinoid. Potential latitudinal variations on the effects of ocean acidification were also investigated by selecting a polar species (Odontaster validus), a temperate species (Patiriella regularis), and a tropical species (Arachnoides placenta). The effects of reduced seawater pH levels on the fertilization of gametes, larval survival and morphometrics on the aforementioned species were evaluated under experimental conditions. The pH levels considered for this research include ambient seawater (pH 8.1 or pH 8.2), levels predicted for 2100 (pH 7.7 and pH 7.6) and the extreme pH of 7.0, adjusted by bubbling CO2 gas into filtered seawater. Fertilization for Odontaster validus and Patiriella regularis for the predicted scenarios for 2100 was robust, whereas fertilization was significantly reduced in Arachnoides placenta. Larval survival was robust for the three species at pH 7.8, but numbers declined when pH dropped below 7.6. Normal A. placenta larvae developed in pH 7.8, whereas smaller larvae were observed for O. validus and P. regularis under the same pH treatment. Seawater pH levels below 7.6 resulted in smaller and underdeveloped larvae for all three species. The greatest effects were expected for the Antarctic asteroid O. validus but overall the tropical sand dollar A. placenta was the most affected by the reduction in seawater pH. The effects of ocean acidification on the asteroids O. validus and P. regulars, and the sand dollar A. placenta are species-specific. Several parameters, such as taxonomic differences, physiology, genetic makeup and the population's evolutionary history may have contributed to this variability. This study highlights the vulnerability of the early developmental stages and the complexity of ocean acidification. However, future research is needed to understand the effects at individual, community and ecosystem levels.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Reduction in global ocean pH due to the uptake of increased atmospheric CO2 is expected to negatively affect calcifying organisms, including the planktonic larval stages of many marine invertebrates. Planktonic larvae play crucial roles in the benthic-pelagic life cycle of marine organisms by connecting and sustaining existing populations and colonizing new habitats. Calcified larvae are typically denser than seawater and rely on swimming to navigate vertically structured water columns. Larval sand dollars Dendraster excentricus have calcified skeletal rods supporting their bodies, and propel themselves with ciliated bands looped around projections called arms. Ciliated bands are also used in food capture, and filtration rate is correlated with band length. As a result, swimming and feeding performance are highly sensitive to morphological changes. When reared at an elevated PCO2 level (1000 ppm), larval sand dollars developed significantly narrower bodies at four and six-arm stages. Morphological changes also varied between four observed maternal lineages, suggesting within-population variation in sensitivity to changes in PCO2 level. Despite these morphological changes, PCO2 concentration alone had no significant effect on swimming speeds. However, acidified larvae had significantly smaller larval stomachs and bodies, suggesting reduced feeding performance. Adjustments to larval morphologies in response to ocean acidification may prioritize swimming over feeding, implying that negative consequences of ocean acidification are carried over to later developmental stages.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GOMES, Carlos E. M. et al. Effect of trypsin inhibitor from Crotalaria pallida seeds on Callosobruchus maculatus (cowpea weevil) and Ceratitis capitata (fruit fly). Plant Physiology and Biochemistry (Paris), v. 43, n. 12, p. 1095-1102, 2005.ISSN 0981-9428. DOI:10.1016/j.plaphy.2005.11.004.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

GOMES, Carlos E. M. et al. Effect of trypsin inhibitor from Crotalaria pallida seeds on Callosobruchus maculatus (cowpea weevil) and Ceratitis capitata (fruit fly). Plant Physiology and Biochemistry (Paris), v. 43, n. 12, p. 1095-1102, 2005.ISSN 0981-9428. DOI:10.1016/j.plaphy.2005.11.004.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Background: Assessing the chemical or bacterial contamination in marine waters and sediments is a very common approach to evaluate marine pollution and associated risks. However, toxicity and organic pollution of beach sands have not yet been considered, except in adjacent waters. In the present study, the toxicity and the chemical contamination of natural beach sands collected 20 m from the shoreline at two sites located on the Mediterranean Sea (Marseille and La Marana, Corsica) were studied. Results: Up to 16.93% (net percentage) abnormal or dead larvae was observed in elutriates prepared from the urban beach sand sample (Marseille); no significant toxicity was observed in the sample collected from the reference beach in La Marana. Results of Fourier transform infrared spectroscopy analyses revealed that no microplastics were present in either of the samples. Several polycyclic aromatic hydrocarbons [PAHs] in both samples and a larger number of individual PAHs in the urban sample than in the sample collected from the reference beach were detected. In addition, the antioxidant dioctyldiphenylamine was detected in both beach sand samples, whereby a higher concentration was found in La Marana than in Marseille. Calculated PAH concentrations in elutriates were generally higher than measured ones. Conclusions: The results of this preliminary study provide evidence of toxicity and the presence of organic trace contaminants in beach sands from France. According to our results, monitoring using a combination of biotests and chemical analyses is recommended, especially of sediments from beaches abandoned to urban and industrial areas.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Leishmaniasis is a complex parasitic disease caused by intracellular protozoans of the genus Leishmania mainly transmitted by the bite of sand flies. In Italy, leishmaniasis is caused by Leishmania infantum, responsible for the human visceral and canine leishmaniases (HVL and CanL, respectively). Within Emilia-Romagna region, Italy, recent molecular studies indicated that L. infantum strains circulating in dogs and humans are different. This suggests that an animal reservoir other than dog should be evaluated in the epidemiology of HVL in Emilia-Romagna. Therefore, the main aim of this PhD project was to investigate the role of wild and peridomestic mammals as potential animal reservoirs of L. infantum in the regional zones where HVL foci are still active, also evaluating the possible role of arthropod vectors other than phlebotomine sandflies as vectors of Leishmania spp. in the sylvatic cycle of the protozoa. Overall, 206 specimens of different animal species (roe deer, rats, mice, badgers, hares, polecats, foxes, beech martens, bank voles, hedgehogs, and shrews), collected in Emilia-Romagna were screened for Leishmania with a real-time PCR, revealing a prevalence of 33% for roe deer (first report in this species). Positivity was also found in brown rats (10.6%), black rats (13.1%), mice (10%), badgers (25%), hedgehogs (80%) and bank voles (11%). To distinguish the two strains of L. infantum circulating in Emilia-Romagna, a nested PCR protocol optimized for animal tissues was developed, demonstrating that over 90% of L. infantum infections in roe deer were due to the strain isolated from humans and suggesting their possible role as reservoirs in the study area. Furthermore, the presence of Leishmania kDNA was detected in unfed larvae, nymphs and males of questing Ixodes ricinus ticks collected in regional parks of Emilia-Romagna suggesting their possible role in the transmission of L. infantum in a sylvatic or rural cycle.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Last instar larvae and pupae of Ourocnemis archytas (Lepidoptera: Riodinidae) are described for the first time and compared with those of Anteros formosus, which are also described in detail. Last instars of both species present body covered with long white plumose setae, a row of orange balloon setae on the prothoracic shield, and clusters of perforated cupola organs (PCOs) near the spiracles; differences are the black cephalic capsule, the placement and format of balloon setae cluster, and the presence of enlarged black tips on some plumose setae. Pupae of O. archytas resemble that of Anteros, covered with the last instar setae and with no balloon setae. Characteristics of the immature stages of these two genera could be useful to establish the still unresolved relationship between them. A summary of the host plants of Helicopini is presented, showing a polyphagous pattern for Anteros, recorded in 21 host plant families, which contrasts with the specialized diet observed in Helicopis and Sarota. 

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Second record of bioluminescence in larvae of Xantholinus Dejean, (Staphylinidae, Xantholinini) from Brazil. Bioluminescent Xantholinus larvae (Xantholinini, Staphylinidae) were collected in the Cerrado biome of Mato Grosso state, Brazil. These larvae are morphologically similar to the first bioluminescent larvae of this genus collected in the Atlantic Forest in São Paulo state; however they differ by their bioluminescent emission.