840 resultados para oropharyngeal colonisation
Resumo:
Some of the factors affecting colonisation of a colonisation sampler, the Standard Aufwuchs Unit (S. Auf. U.) were investigated, namely immersion period, whether anchored on the bottom or suspended, and the influence of riffles. It was concluded that a four-week immersion period was best. S. Auf. U. anchored on the bottom collected both more taxa and individuals than suspended ones. Fewer taxa but more individuals colonised S. Auf. U. in the potamon zone compared to the rhithron zone with a consequent reduction in the values of pollution indexes and diversity. It was concluded that a completely different scoring system was necessary for lowland rivers. Macroinvertebrates colonising S. Auf. U. in simulated streams, lowland rivers and the R. Churnet reflected water quality. A variety of pollution and diversity indexes were applied to results from lowland river sites. Instead of these, it was recommended that an abbreviated species - relative abundance list be used to summarise biological data for use in lowland river surveillance. An intensive study of gastropod populations was made in simulated streams. Lynnaea peregra increased in abundance whereas Potamopyrgas jenkinsi decreased with increasing sewage effluent concentration. No clear-cut differences in reproduction were observed. The presence/absence of eight gastropod taxa was compared with concentrations of various pollutants in lowland rivers. On the basis of all field work it appeared that ammonia, nitrite, copper and zinc were the toxicants most likely to be detrimental to gastropods and that P. jenkinsi and Theodoxus fluviatilis were the least tolerant taxa. 96h acute toxicity tests of P. jenkinsi using ammonia and copper were carried out in a flow-through system after a variety of static range finding tests. P. jenkinsi was intolerant to both toxicants compared to reports on other taxa and the results suggested that these toxicants would affect distribution of this species in the field.
Resumo:
Palliative care involves a multi-professional team approach to the provision of active, holistic care for patients and their families when the patient's disease is no longer responsive to curative treatment. Patient care encompasses medical and pharmacological intervention for symptom control, together with psychological, spiritual and social support for patients and families. Care is provided by teams in hospice, hospital or community environments. Although traditionally associated with providing care for cancer patients, palliative care services are increasingly providing for patients with non-malignant disease. Symptoms commonly associated with terminal phase of disease include pain, nausea, agitation, respiratory symptoms and general fatigue. During the last few days of life, patients may become weak, resulting in difficulty taking oral medication and have periods of unconsciousness. Some patients may require drug administration via subcutaneous infusion. A proportion of patients may develop difficulty clearing respiratory secretions causing a characteristic ‘death rattle’, which although not generally considered to be distressing for the patient, is often treated with a variety of anticholinergic drugs in an attempt to reduce the ‘noisy breathing’ for the benefit of relatives and others who may be closely associated with the patient.This study examined treatment of death rattle in two Hospices focusing on objective and subjective outcome measures in order to determine the efficacy of anticholinergic regimens in current use. Qualitative methods were employed to elicit attitudes of professionals and carers working closely with the patient. The number of patients recruited and monitored were small, many confounding factors were identified which questioned firstly the clinical rationale for administering anticholinergic drugs routinely to treat death rattle and secondly, the ethics of administering drug regimens to patients to treat death rattle with the primary aim of relieving distress for others. Ethnical issues, including those of consent are discussed in relation to their impact on the methodology of end of life studies in medicines management in palliative care.
Resumo:
DUE TO COPYRIGHT RESTRICTIONS ONLY AVAILABLE FOR CONSULTATION AT ASTON UNIVERSITY LIBRARY AND INFORMATION SERVICES WITH PRIOR ARRANGEMENT
Resumo:
Ce mémoire analyse le processus de romanisation et de colonisation de Xanten-Vetera, une région frontalière de l’Empire romain située en basse Rhénanie dans la province romaine de Germania inferior. À l’intérieur d’un cadre temporel inclus entre les conquêtes de Jules César et le milieu du second siècle apr. J.-C., l’étude cherche à comprendre et à restituer la présence militaire ainsi que le développement des peuplades civiles sur place, du fait des transferts de population et de l’immigration gallo-romaine. Le processus de romanisation est analysé en tenant compte des réalités ethnographiques, sociales et culturelles et selon les théories les plus actuelles de la recherche moderne sur ce sujet. Comme il s’agit d’une agglomération située sur une voie fluviale en périphérie de l’Empire, le concept de « frontière » y est évalué afin d’estimer si Xanten-Vetera constituait une zone de convergence ou de divergence par rapport à l’espace rhénan. Dans un deuxième temps, cette recherche analyse le contexte militaire et social durant lequel l’empereur Trajan prit la décision d’octroyer le statut de colonie à ce territoire qui devint la Colonia Ulpia Traiana. Cette démarche qui se veut régionale souligne la nature particulière de l’histoire de Xanten-Vetera sous le Haut Empire ; les migrations et les tragédies à l’intérieur de cet espace géographique ont façonné un endroit au destin unique en Germanie et dans l’Empire romain. Enfin, ce travail fournit un exemple pertinent de l’évolution des motivations qui ont guidé les politiques coloniales sous les Julio-Claudiens, les Flaviens et les Antonins et suggère l’essor des groupes de pression non militaires dans ce contexte.
Resumo:
The inflation pressure of the endotracheal tube cuff can cause ischemia of the tracheal mucosa at high pressures; thus, it can cause important tracheal morbidity and tracheal microaspiration of the oropharyngeal secretion, or it can even cause pneumonia associated with mechanical ventilation if the pressure of the cuff is insufficient. In order to investigate the effectiveness of the RUSCH® 7.5 mm endotracheal tube cuff, this study was designed to investigate the physical and mechanical aspects of the cuff in contact with the trachea. For this end, we developed an in vitro experimental model to assess the flow of dye (methylene blue) by the inflated cuff on the wall of the artificial material. We also designed an in vivo study with 12 Large White pigs under endotracheal intubation. We instilled the same dye in the oral cavity of the animals, and we analyzed the presence or not of leakage in the trachea after the region of the cuff after their deaths (animal sacrifice). All cuffs were inflated at the pressure of 30 cmH2O. We observed the passage of fluids through the cuff in all in vitro and in vivo experimental models. We conclude that, as well as several other cuff models in the literature, the RUSCH® 7.5 mm tube cuffs are also not able to completely seal the trachea and thus prevent aspiration of oropharyngeal secretions. Other prevention measures should be taken.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Os cuidados gerais relativos ao paciente submetido ao transplante de medula óssea (TMO) incluem avaliações odontológicas rotineiras, as quais devem estar inseridas em um contexto multiprofissional. A cavidade oral constitui um sítio propício a infecções com grande potencial de desenvolvimento de bacteremia, sendo que lesões infecciosas devem ser previamente tratadas e controladas pelo cirurgião-dentista. O objetivo desta revisão é discutir questões em destaque na literatura nacional e internacional referentes aos quadros inflamatórios e infecciosos orais de importância para o paciente transplantado de medula óssea, tanto os predisponentes a complicações durante o transplante, quanto os que ocorrem durante e após a terapia mielossupressora. Destaca-se na literatura a doença periodontal avançada, a qual constitui um quadro infeccioso crônico que deve ser evitado ou controlado durante o TMO, principalmente devido à presença de S. viridans. Os fatores de risco para mucosite oral (OM), doença do enxerto contra o hospedeiro (DECH) e xerostomia ainda não estão definidos, principalmente para OM e DECH. São citadas na literatura alternativas promissoras de tratamento para OM, tais como crioterapia, administração de fatores de crescimento e laserterapia. O risco aumentado de cárie é controverso e, dentre as lesões fúngicas e virais, destacam-se as infecções orais e de orofaringe por Candida e pela família de herpesvírus, de importância clínica considerável. Em pacientes pediátricos são relevantes as alterações craniofaciais e dentárias, decorrentes principalmente da radioterapia.
Resumo:
Various molecular systems are available for epidemiological, genetic, evolutionary, taxonomic and systematic studies of innumerable fungal infections, especially those caused by the opportunistic pathogen C. albicans. A total of 75 independent oral isolates were selected in order to compare Multilocus Enzyme Electrophoresis (MLEE), Electrophoretic Karyotyping (EK) and Microsatellite Markers (Simple Sequence Repeats - SSRs), in their abilities to differentiate and group C. albicans isolates (discriminatory power), and also, to evaluate the concordance and similarity of the groups of strains determined by cluster analysis for each fingerprinting method. Isoenzyme typing was performed using eleven enzyme systems: Adh, Sdh, M1p, Mdh, Idh, Gdh, G6pdh, Asd, Cat, Po, and Lap (data previously published). The EK method consisted of chromosomal DNA separation by pulsed-field gel electrophoresis using a CHEF system. The microsatellite markers were investigated by PCR using three polymorphic loci: EF3, CDC3, and HIS3. Dendrograms were generated by the SAHN method and UPGMA algorithm based on similarity matrices (S(SM)). The discriminatory power of the three methods was over 95%, however a paired analysis among them showed a parity of 19.7-22.4% in the identification of strains. Weak correlation was also observed among the genetic similarity matrices (S(SM)(MLEE) x S(SM)(EK) x S(SM)(SSRs)). Clustering analyses showed a mean of 9 +/- 12.4 isolates per cluster (3.8 +/- 8 isolates/taxon) for MLEE, 6.2 +/- 4.9 isolates per cluster (4 +/- 4.5 isolates/taxon) for SSRs, and 4.1 +/- 2.3 isolates per cluster (2.6 +/- 2.3 isolates/taxon) for EK. A total of 45 (13%), 39(11.2%), 5 (1.4%) and 3 (0.9%) clusters pairs from 347 showed similarity (Si) of 0.1-10%, 10.1-20%, 20.1-30% and 30.1-40%, respectively. Clinical and molecular epidemiological correlation involving the opportunistic pathogen C. albicans may be attributed dependently of each method of genotyping (i.e., MLEE, EK, and SSRs) supplemented with similarity and grouping analysis. Therefore, the use of genotyping systems that give results which offer minimum disparity, or the combination of the results of these systems, can provide greater security and consistency in the determination of strains and their genetic relationships. (C) 2010 Elsevier B.V. All rights reserved.
Resumo:
Swallowing dynamics involves the coordination and interaction of several muscles and nerves which allow correct food transport from mouth to stomach without laryngotracheal penetration or aspiration. Clinical swallowing assessment depends on the evaluator`s knowledge of anatomic structures and of neurophysiological processes involved in swallowing. Any alteration in those steps is denominated oropharyngeal dysphagia, which may have many causes, such as neurological or mechanical disorders. Videofluoroscopy of swallowing is presently considered to be the best exam to objectively assess the dynamics of swallowing, but the exam needs to be conducted under certain restrictions, due to patient`s exposure to radiation, which limits periodical repetition for monitoring swallowing therapy. Another method, called cervical auscultation, is a promising new diagnostic tool for the assessment of swallowing disorders. The potential to diagnose dysphagia in a noninvasive manner by assessing the sounds of swallowing is a highly attractive option for the dysphagia clinician. Even so, the captured sound has an amount of noise, which can hamper the evaluator`s decision. In that way, the present paper proposes the use of a filter to improve the quality of audible sound and facilitate the perception of examination. The wavelet denoising approach is used to decompose the noisy signal. The signal to noise ratio was evaluated to demonstrate the quantitative results of the proposed methodology. (C) 2007 Elsevier Ltd. All rights reserved.
Resumo:
An unusual saltwater population of the "freshwater" crocodilian, Crocodylus johnstoni, was studied in the estuary of the Limmen Bight River in Australia's Northern Territory and compared with populations in permanently freshwater habitats. Crocodiles in the river were found across a large salinity gradient, from fresh water to a salinity of 24 mg.ml-1, more than twice the body fluid concentration. Plasma osmolarity, concentrations of plasma Na+, Cl-, and K+, and exchangeable Na+ pools were all remarkably constant across the salinity spectrum and were not substantially higher or more variable than those in crocodiles from permanently freshwater habitats. Body fluid volumes did not vary; condition factor and hydration status of crocodiles were not correlated with salinity and were not different from those of crocodiles from permanently fresh water. C. johnstoni clearly has considerable powers of osmoregulation in waters of low to medium salinity. Whether this osmoregulatory competence, extends to continuously hyperosmotic environments is not known, but distributional data suggest that C. johnstoni in hyperosmotic conditions may require periodic access to hypoosmotic water. The study demonstrates a physiological capacity for colonisation of at least some estuarine waters by this normally stenohaline freshwater crocodilian.
Resumo:
The effect of aging on host resistance to systemic candidosis was assessed by monitoring the course of infection in 16-month-old CBA/CaH mice (aged non-immune) and in a comparable group that had been infected with a sublethal dose of Candida albicans at 6 weeks of age (aged immune). Aged non-immune mice showed rapid progression of the disease, with a marked increase in the number of mycelia in the brain and kidney, and early morbidity, Foci of myocardial necrosis were evident, but inflammatory cells were sparse. The histological picture in the aged immune mice was similar to that in the aged non-immune group, although fewer mycelial aggregates were seen. Both groups of aged mice showed a significantly lower fungal burden in the brain on day 1 of infection, but on day 4, colony counts increased significantly in the aged non-immune mice, Comparison of cytokine gene expression in the infected brains showed that the relative amount of interferon-gamma and tumour necrosis factor-alpha cDNA were similar in all three groups. Interleukin-6 was elevated in both infected non-immune and uninfected aged mice. Aged immune mice showed no morbidity after challenge, and both colonisation and tissue damage were reduced in comparison with the aged non-immune animals.
Resumo:
Oropharyngeal candidiasis is associated with defects in cell-mediated immunity, and is commonly seen in immunocompromised patients. We have previously shown that T-cell-deficient BALB/c nude (nu/nu) mice are extremely susceptible to oropharyngeal candidiasis, and that recovery from a chronic infection is dependent on CD4 T lymphocytes. In this study we describe the local tissue cytokine profile in lymphocyte-reconstituted immunodeficient mice and their euthymic counterparts. Mice were infected orally with 10(8) cells of the yeast Candida albicans , and oral tissues sampled on days 0, 4, 8, and 14. Nude mice were reconstituted with 3 x 10(7) naive lymphocytes following oral inoculation. Interleukin (IL)-6, interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha were identified in the oral tissues of infected euthymic mice recovering from oral infection, as well as naive controls. TNF-alpha was identified in nude oral tissue on days 4 and 8, but only after lymphocyte reconstitution. No IL-2, IL-4 or IL-10 was detected in either euthymic or athymic mice at any time-point throughout the experiment. This study confirms the functional activity of T lymphocytes in reconstituted nude mice, and suggests that TNF-alpha may be an important mediator in the recovery from oropharyngeal candidiasis.
Resumo:
The spatial pattern of outbreaks of pink wax scale, Ceroplastes rubens Maskell, within and among umbrella trees, Schefflera actinophylla (Endl.), in southeastern Queensland was investigated. Pink wax scale was common on S. actinophylla, with approximately 84% of trees positive for scale and 14% of bees recording outbreak densities exceeding 0.4 adults per leaflet. Highly aggregated distributions of C. rubens occur within and among umbrella trees. Clumped distributions within trees appear to result from variable birth and death rates and limited movement of first instar crawlers. The patchy distribution of pink wax scale among trees is probably a consequence of variation in dispersal success of scale, host and environmental suitability for establishment and rates of biological control. Pink wax scale was more prevalent on trees in roadside positions and in exposed situations, indicating that such trees are more suitable and/or susceptible to scale colonisation.