899 resultados para carotenoids, passion fruit


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A anomalia do epicarpo da goiaba, comumente relatada por agricultores e técnicos como o "anelamento juvenil da goiaba", tem causado preocupação devido à desinformação sobre o assunto. O objetivo deste estudo foi analisar quimicamente as concentrações de substâncias fenólicas e carotenoides na região do epicarpo de goiabas afetadas pelo "anelamento", visando a caracterizar essa anomalia previamente relatada. Foram analisadas substâncias fenólicas (taninos, flavonas/flavonóis, antocianinas e fenóis totais) e carotenoides em epicarpos de frutos verdes e maduros de goiabeiras cv. Paluma, com e sem anomalia. O delineamento experimental adotado foi o inteiramente casualizado, sendo estabelecidos seis tratamentos com o epicarpo dos frutos maduro sem anomalia na região inferior (FMSI); frutos maduros sem injuria na região superior (FMSS); frutos verdes sem anomalia na região inferior (FVSI); frutos verdes sem anomalia na região superior (FVSS); frutos verdes com anomalia na região inferior (FVCI); frutos verdes com anomalia na região superior (FVCS). Dentre as substâncias analisadas, os carotenoides, os taninos e os fenóis totais mostram indicativos para a caracterização do anelamento. Tanto substâncias fenólicas quanto carotenoides apresentam propriedades antioxidantes e, dessa forma, poderiam estar relacionadas à defesa antioxidante causada por um fator de estresse ainda desconhecido, que promove o "anelamento" característico apresentado pelas goiabas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

No processo celular de obtenção de energia, são gerados compostos chamados espécies reativas de oxigênio (ERO) que, em excesso, podem causar danos celulares. Estresse oxidativo resulta do desequilíbrio no estado de óxido-redução a favor da oxidação. Dos mecanismos de defesa antioxidante, participam enzimas endógenas e algumas vitaminas e minerais. A vitamina E encontra-se no plasma e na partícula de LDL, protegendo lipídeos da oxidação. Estudos observacionais relataram associação inversa entre ingestão de vitamina E e risco cardiometabólico (RCM). Entretanto, ensaios clínicos não comprovaram a eficácia de sua suplementação nos desfechos cardiometabólicos. A vitamina C participa do sistema de regeneração da vitamina E, mantendo o potencial antioxidante plasmático. Dados sobre os benefícios de sua suplementação na redução do risco cardiometabólico são inconclusivos. A atividade antioxidante dos carotenoides é responsável, em parte, por seu papel protetor contra doenças cardiovasculares e cânceres. A suplementação desse nutriente também não trouxe resultados consistentes no que se refere à redução do RCM. A participação do zinco e do selênio na defesa antioxidante vem sendo estudada mais recentemente, mas a sua suplementação em indivíduos com níveis séricos normais e ingestão adequada na dieta desses minerais não parece ser necessária. De um modo geral, há muita controvérsia sobre o papel desses micronutrientes no RCM. Estudos epidemiológicos sugerem que o consumo de substâncias antioxidantes provenientes da dieta ou dietas ricas em frutas e hortaliças diminui o RCM. Mais estudos são necessários antes de se recomendar o uso de antioxidantes isolados na forma de suplementos para tal finalidade.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Mutualistic networks are crucial to the maintenance of ecosystem services. Unfortunately, what we know about seed dispersal networks is based only on bird-fruit interactions. Therefore, we aimed at filling part of this gap by investigating bat-fruit networks. It is known from population studies that: (i) some bat species depend more on fruits than others, and (ii) that some specialized frugivorous bats prefer particular plant genera. We tested whether those preferences affected the structure and robustness of the whole network and the functional roles of species. Nine bat-fruit datasets from the literature were analyzed and all networks showed lower complementary specialization (H(2)' = 0.3760.10, mean 6 SD) and similar nestedness (NODF = 0.5660.12) than pollination networks. All networks were modular (M=0.32 +/- 0.07), and had on average four cohesive subgroups (modules) of tightly connected bats and plants. The composition of those modules followed the genus-genus associations observed at population level (Artibeus-Ficus, Carollia-Piper, and Sturnira-Solanum), although a few of those plant genera were dispersed also by other bats. Bat-fruit networks showed high robustness to simulated cumulative removals of both bats (R = 0.55 +/- 0.10) and plants (R = 0.68 +/- 0.09). Primary frugivores interacted with a larger proportion of the plants available and also occupied more central positions; furthermore, their extinction caused larger changes in network structure. We conclude that bat-fruit networks are highly cohesive and robust mutualistic systems, in which redundancy is high within modules, although modules are complementary to each other. Dietary specialization seems to be an important structuring factor that affects the topology, the guild structure and functional roles in bat-fruit networks.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Carotenoids are biosynthetic organic pigments that constitute an important class of one-dimensional pi-conjugated organic molecules with enormous potential for application in biophotonic devices. In this context, we studied the degenerate two-photon absorption (2PA) cross-section spectra of two carotenoid compounds (beta-carotene and beta-apo-8'-carotenal) employing the conventional and white-light-continuum Z-scan techniques and quantum chemistry calculations. Because carotenoids coexist at room temperature as a mixture of isomers, the 2PA spectra reported here are due to samples containing a distribution of isomers, presenting distinct conjugation length and conformation. We show that these compounds present a defined structure on the 2PA spectra, that peaks at 650 nm with an absorption cross-section of approximately 5000 GM, for both compounds. In addition, we observed a 2PA band at 990 nm for beta-apo-8'-carotenal, which was attributed to a overlapping of I(I)B(u) +-like and 2(I)Ag(-)-like states, which are strongly one- and two-photon allowed, respectively. Spectroscopic parameters of the electronic transitions to singlet-excited states, which are directly related to photophysical properties of these compounds, were obtained by fitting the 2PA spectra using the sum-over-states approach. The analysis and interpretations of the 2PA spectra of the investigated carotenoids were supported by theoretical predictions of one- and two-photon transitions carried out using the response functions formalism within the density functional theory framework, using the long-range corrected CAM-B3LYP functional. (C) 2011 American Institute of Physics. [doi:10.1063/1.3590157]

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Organic-inorganic hybrid materials can be prepared dispersing organic species into well-defined inorganic nanoblocks. This paper describes the immobilization of natural dyes from the extract of the Brazilian acai-fruit into two types of layered hexaniobate precursors derived from H(2)K(2)Nb(6)O(17): (i) colloidal dispersion of niobate exfoliated nanoparticles and (ii) niobate pre-intercalated with tetraethylammonium cations (TEA(+)). The restacking of exfoliated particles in the presence of acai anthocyanins promotes their intercalation and produces stacked layers showing large basal spacing (ca. 50 angstrom). The TEA(+) pre-intercalated niobate provides particles with lower content of dye species than the exfoliated precursor but with higher degree of organization and regularity according to X-ray diffraction data and images obtained by electron microscopies. Vibrational (FTIR and Raman) and (13)C NMR spectroscopies indicate the presence of flavylium cations in the hybrid materials and spectral profiles characteristic of glycosylated anthocyanidins. According to thermal analysis results, the purplish hybrids materials are more stable than the free acai-dyes. One hybrid sample was heated under air up to 170 degrees C and maintained at this temperature for 240 min. No weight loss events were observed and the sample retained its original color, indicating that the intercalation of anthocyanin into hexaniobate increases its thermal stability. Considering the structural, chemical, optical and thermal properties of the synthesized hybrid materials, they might be good candidates to be investigated for future specialized applications.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As insects increase in radiotolerance as they develop and usually several developmental stages of the pest may be present in the fresh shipped commodity, it is important to know the radiation susceptibility of the stages of the target insect before the establishment of ionizing radiation quarantine treatments. This study was performed to determine the radiotolerance of eggs of the oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), to gamma radiation. This species is considered as one of the most serious worldwide pests for temperate fruits, especially peaches. Eggs (12 h old) were exposed to 0 (control), 25, 35, 50, 75, 100, 125 and 150 Gy of gamma radiation. Surviving larvae were allowed to feed on an artificial diet. Three days after irradiation, it was verified that larvae`s cephalic capsules were significantly affected by gamma radiation, and the estimated mean LD(90) and LD(99) were 66.3 Gy and 125.8 Gy, respectively. Oriental fruit moth eggs revealed to be quite radiosensitive and very low doses as 50 Gy were sufficient to disrupt G. molesta embryogenesis. At 25 Gy, only male adults originated from the surviving larvae and, after mating with untreated fertile females, shown to be sterile. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The main aim of this work was to produce fruit wines from pulp of gabiroba, cacao, umbu, cupuassu and jaboticaba and characterize them using gas chromatography-mass spectrometry for determination of minor compounds and gas chromatography-flame ionization detection for major compounds. Ninety-nine compounds (C(6) compounds, alcohols, monoterpenic alcohols, monoterpenic oxides, ethyl esters, acetates, volatile phenols, acids, carbonyl compounds, sulfur compounds and sugars) were identified in fruit wines. The typical composition for each fruit wine was evidenced by principal component analysis and Tukey test. The yeast UFLA CA 1162 was efficient in the fermentation of the fruit pulp used in this work. The identification and quantification of the compounds allowed a good characterization of the fruit wines. With our results, we conclude that the use of tropical fruits in the production of fruit wines is a viable alternative that allows the use of harvest surpluses and other underused fruits, resulting in the introduction of new products into the market. (C) 2010 Elsevier Ltd. All rights reserved.