La formaci?? dels primers escolapis a Catalunya : 1683-1742. 'La formaci??n de los primeros escolapios en Catalu??a : 1683-1742'

Resumen tomado parcialmente de la publicaci??n

Panoràmica de la folklorística valenciana: autors, períodes, textos i contextos

En aquest estudi es fa un repàs a la història de la folklorísica valenciana a través de quatre períodes. Entre 1873 i 1912, la recol·lecció folklòrica està encara molt lligada a la creació literària. Entre 1912 i 1939, s’hi poden trobar els primers intents d’institucionalització i l’emancipació del folklore com a disciplina. Durant el franquisme, de 1939 a 1975, es truncarien molts esforços previs, encara que apareixerien figures individuals rellevants i interessants campanyes per al folklore musical. Finalment, des de 1975 a l’actualitat s’observa un gran salt qualitatiu i quantitatiu pel que fa a la recol·lecció i la recerca folklòrica.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

O corpo e seus textos : o estetico, o politico e o pedagogico na dança

Universidade Estadual de Campinas. Faculdade de Educação Física

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Autoria no ensino de química: análise de textos escritos por alunos de graduação

A utilização de textos de divulgação científica no ensino formal tem sido discutida por pesquisadores da área de educação em ciências. Tais discussões sugerem que esses textos podem funcionar como instrumento de motivação em sala de aula, organizando explicações e estimulando debates. Nesta perspectiva, foi aplicada uma proposta de ensino pautada no uso de capítulos do livro Tio Tungstênio: Memórias de uma Infância Química, de Oliver Sacks. A proposta, que envolveu a produção de textos, pelos estudantes, sobre conteúdos do livro, foi aplicada em uma disciplina do Ensino Superior de química. Os textos foram analisados segundo a Análise do Discurso de linha francesa, especificamente com relação à noção de autoria.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Development and characterization of microsatellite markers for Psychotria tenuinervis (Rubiaceae), a shrub species from the Atlantic forest, and primers transferability from Coffea

The shrub species Psychotria tenuinervis (Rubiaceae) is native to the Brazilian Atlantic forest and is largely found within natural and disturbed forest fragments. Aiming to develop studies on population genetic structure of forest fragment species, eigth microsatellite markers were developed for P. tenuinervis. Also, 15 loci already developed for Coffea (Rubiaceae) were tested for transferability to this species. We utilized 45 individuals from natural populations of three different fragments-anthropic edge, interior fragment and natural edge, within the Brazilian Atlantic forest. The average number of alleles per locus was 2.5 (two-four alleles/locus). These loci will be useful for future population genetic studies aiming to the conservation and management of this species.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

EFFECT OF METAL PRIMERS ON MICROTENSILE BOND STRENGTH BETWEEN ZIRCONIA AND RESIN CEMENTS

Statement of problem. There are no established clinical procedures for bonding zirconia to tooth structure using resin cements. Purpose. The purpose of this study was to evaluate the influence of metal primers, resin cements, and aging on bonding to zirconia. Material and methods. Zirconia was treated with commercial primers developed for bonding to metal alloys (Metaltite, Metal Primer II, Alloy Primer or Totalbond). Non-primed specimens were considered as controls. One-hundred disk-shaped specimens (19 x 4 mm) were cemented to composite resin substrates using Panavia or RelyX Unicem (n=5). Microtensile bond strength specimens were tested after 48 hours and 5 months (150 days), and failure modes were classified as type 1 (between ceramic/cement), 2 (between composite resin/cement) or 3 (mixed). Data were analyzed by 3-way ANOVA and Multiple Comparison Tukey test (alpha=.05). Results. The interactions primer/luting system (P=.016) and luting system/storage time (P=.004) were statistically significant. The use of Alloy Primer significantly improved the bond strength of RelyX Unicem (P<.001), while for Panavia, none of the primers increased the bond strength compared to the control group. At 48 hours, Panavia had statistically higher bond strength (P=.004) than Unicem (13.9 +/- 4.4MPa and 10.2 +/- 6.6MPa, respectively). However, both luting systems presented decreasing, statistically similar; values after aging (Panavia: 3.6 +/- 2.2MPa; Unicem: 6.1 +/- 5.3MPa). At 48 hours, Alloy Primer/Unicem had the lowest incidence of type 1 failure (8%). After aging, all the groups showed a predominance of type 1 failures. Conclusions. The use of Alloy Primer improved bond strength between RelyX Unicem and zirconia. Though the initial values obtained with Panavia were significantly higher than RelyX Unicem, after aging, both luting agents presented statistically similar performances. (J Prosthet Dent 2011;105:296-303)

Em busca de uma nova s??ntese para a administra????o p??blica: textos para discuss??o

"Em Busca de uma Nova S??ntese para a Administra????o P??blica" ?? uma pesquisa internacional desenvolvida em rede por acad??micos e dirigentes p??blicos da Austr??lia, Brasil, Canad??, Cingapura, Holanda e Reino Unido. Procura contribuir para a incorpora????o de inova????es e ideias promissoras no enfrentamento dos desafios colocados para o setor p??blico no s??culo 21. A iniciativa parte da constata????o de que o Estado e a sociedade civil interagem com um n??mero crescente de atores e que pol??ticas p??blicas est??o cada vez mais interdependentes, podendo alcan??ar impactos mais amplos do que aqueles originalmente pensados