1000 resultados para car detection
Resumo:
A sensitive assay to identify volatile organic metabolites (VOMs) as biomarkers that can accurately diagnose the onset of breast cancer using non-invasively collected clinical specimens is ideal for early detection. Therefore the aim of this study was to establish the urinary metabolomic profile of breast cancer patients and healthy individuals (control group) and to explore the VOMs as potential biomarkers in breast cancer diagnosis at early stage. Solid-phase microextraction (SPME) using CAR/PDMS sorbent combined with gas chromatography–mass spectrometry was applied to obtain metabolomic information patterns of 26 breast cancer patients and 21 healthy individuals (controls). A total of seventy-nine VOMs, belonging to distinct chemical classes, were detected and identified in control and breast cancer groups. Ketones and sulfur compounds were the chemical classes with highest contribution for both groups. Results showed that excretion values of 6 VOMs among the total of 79 detected were found to be statistically different (p < 0.05). A significant increase in the peak area of (−)-4-carene, 3-heptanone, 1,2,4-trimethylbenzene, 2-methoxythiophene and phenol, in VOMs of cancer patients relatively to controls was observed. Statiscally significant lower abundances of dimethyl disulfide were found in cancer patients. Bioanalytical data were submitted to multivariate statistics [principal component analysis (PCA)], in order to visualize clusters of cases and to detect the VOMs that are able to differentiate cancer patients from healthy individuals. Very good discrimination within breast cancer and control groups was achieved. Nevertheless, a deep study using a larger number of patients must be carried out to confirm the results.
Resumo:
Contagious caprine pleuropneumonia (CCPP) is a highly contagious disease caused by Mycoplasma capricolum subsp. capripneumoniae that affects goats in Africa and Asia. Current available methods for the diagnosis of Mycoplasma infection, including cultivation, serological assays, and PCR, are time-consuming and require fully equipped stationary laboratories, which make them incompatible with testing in the resource-poor settings that are most relevant to this disease. We report a rapid, specific, and sensitive assay employing isothermal DNA amplification using recombinase polymerase amplification (RPA) for the detection of M. capricolum subsp. capripneumoniae. We developed the assay using a specific target sequence in M. capricolum subsp. capripneumoniae, as found in the genome sequence of the field strain ILRI181 and the type strain F38 and that was further evidenced in 10 field strains from different geographical regions. Detection limits corresponding to 5 × 10(3) and 5 × 10(4) cells/ml were obtained using genomic DNA and bacterial culture from M. capricolum subsp. capripneumoniae strain ILRI181, while no amplification was obtained from 71 related Mycoplasma isolates or from the Acholeplasma or the Pasteurella isolates, demonstrating a high degree of specificity. The assay produces a fluorescent signal within 15 to 20 min and worked well using pleural fluid obtained directly from CCPP-positive animals without prior DNA extraction. We demonstrate that the diagnosis of CCPP can be achieved, with a short sample preparation time and a simple read-out device that can be powered by a car battery, in <45 min in a simulated field setting.
Resumo:
There is clear evidence that investment in intelligent transportation system technologies brings major social and economic benefits. Technological advances in the area of automatic systems in particular are becoming vital for the reduction of road deaths. We here describe our approach to automation of one the riskiest autonomous manœuvres involving vehicles – overtaking. The approach is based on a stereo vision system responsible for detecting any preceding vehicle and triggering the autonomous overtaking manœuvre. To this end, a fuzzy-logic based controller was developed to emulate how humans overtake. Its input is information from the vision system and from a positioning-based system consisting of a differential global positioning system (DGPS) and an inertial measurement unit (IMU). Its output is the generation of action on the vehicle’s actuators, i.e., the steering wheel and throttle and brake pedals. The system has been incorporated into a commercial Citroën car and tested on the private driving circuit at the facilities of our research center, CAR, with different preceding vehicles – a motorbike, car, and truck – with encouraging results.
Resumo:
Due to its small size and the restrictions on source and listener positions, the design of sound reproduction systems for car cabins is particularly cumbersome. In the present project the measurement of the impulse response between a single loudspeaker and a listener position, with special emphasis on the directional characteristics, will be examined. The propagation paths inside a car are very short, meaning that it is very difficult for the existing commercial measurement systems to resolve the different reflections arriving to the listener. This paper propose a first approach of an algorithm based on time difference of arrival along a measurement technique aiming at finding the reflections and their direction of arrival to the listener. To this end a circular microphone array at a known position is employed, along with Maximum-Length Sequences (MLS) measurement technique. The results are processed so as to extract the directional properties, demonstrate the physical limitations that can influence or prevent this detection in practice. Measurements were carried out in a free-field environment (anechoic chamber) making use of different panels closer around the microphone array. RESUMEN. El diseño de sistemas de reproducción de audio para cabinas de coche es especialmente complicado debido al reducido tamaño del espacio y las restricciones de los altavoces y posiciones de escucha de los ocupantes. En el presente proyecto, se examinan mediciones de la respuesta al impulso entre un altavoz y una posición de escucha con especial énfasis en las características direccionales. Los caminos de propagación de las ondas sonoras dentro de un coche son muy cortos, lo que hace difícil para los instrumentos de medida existentes en el mercado determinar las direcciones de llegada de las diferentes reflexiones que llegan a una posición de escucha. Este trabajo propone una primera aproximación de un algoritmo, basado en las diferencias temporales de llegada de una onda a diferentes puntos de medida, y una particular técnica de medida de la respuesta al impulso para obtener las direcciones de llegada de reflexiones a una posición de escucha. Para ello, se emplea una matriz circular de micrófonos en una posición conocida junto con la técnica de medida MLS (Maximum Length Sequence). Los resultados obtenidos son procesados para extraer la dirección de llegada de las reflexiones acústicas y encontrar las limitaciones que influyan en la detección de dichas reflexiones. Las mediciones se llevan a cabo en un entorno de campo libre y utilizando diferentes superficies reflectantes alrededor de la matriz de micrófonos.
Resumo:
Transportation Systems Center, Cambridge, Mass.
Resumo:
The objective of this thesis was the development of a new detection method of partial discharge (PD) activity in the stator of an electrical hybrid supercar fed by a silicon carbide converter, for which detection with common methods make it very difficult to separate PD pulses from switching noise. This work focused on the analysis and detection of partial discharges making use of an antenna, a peak detector, and an oscilloscope capable of capturing the electromagnetic pulses emitted during PD activity. Validation of the proposed method was done by comparing the partial discharge inception voltage (PDIV) detected by this system with the one obtained from an optical method of proven accuracy, with different rise times and samples. Further development of this method, if proved successful on a full stator, can help increasing the overall reliability of the car, potentially allowing for real time detection of PD activity and predictive maintenance before failure of the insulation system in a hybrid vehicle.
Resumo:
The work described in this Master’s Degree thesis was born after the collaboration with the company Maserati S.p.a, an Italian luxury car maker with its headquarters located in Modena, in the heart of the Italian Motor Valley, where I worked as a stagiaire in the Virtual Engineering team between September 2021 and February 2022. This work proposes the validation using real-world ECUs of a Driver Drowsiness Detection (DDD) system prototype based on different detection methods with the goal to overcome input signal losses and system failures. Detection methods of different categories have been chosen from literature and merged with the goal of utilizing the benefits of each of them, overcoming their limitations and limiting as much as possible their degree of intrusiveness to prevent any kind of driving distraction: an image processing-based technique for human physical signals detection as well as methods based on driver-vehicle interaction are used. A Driver-In-the-Loop simulator is used to gather real data on which a Machine Learning-based algorithm will be trained and validated. These data come from the tests that the company conducts in its daily activities so confidential information about the simulator and the drivers will be omitted. Although the impact of the proposed system is not remarkable and there is still work to do in all its elements, the results indicate the main advantages of the system in terms of robustness against subsystem failures and signal losses.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.