Is size structure a good measure of future trends of plant populations? an empirical approach using five woody species from the Cerrado (Brazilian savanna)

Size distributions in woody plant populations have been used to assess their regeneration status, assuming that size structures with reverse-J shapes represent stable populations. We present an empirical approach of this issue using five woody species from the Cerrado. Considering count data for all plants of these five species over a 12-year period, we analyzed size distribution by: a) plotting frequency distributions and their adjustment to the negative exponential curve and b) calculating the Gini coefficient. To look for a relationship between size structure and future trends, we considered the size structures from the first census year. We analyzed changes in number over time and performed a simple population viability analysis, which gives the mean population growth rate, its variance and the probability of extinction in a given time period. Frequency distributions and the Gini coefficient were not able to predict future trends in population numbers. We recommend that managers should not use measures of size structure as a basis for management decisions without applying more appropriate demographic studies.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Seasonal variation of soluble carbohydrates and starch in Echinolaena inflexa, a native grass species from the Brazilian savanna, and in the invasive grass Melinis minutiflora

Echinolaena inflexa (Poir.) Chase is an abundant C3 grass species with high biomass production in the Brazilian savanna (cerrado); Melinis minutiflora Beauv. is an African C4 forage grass widespread in cerrado and probably displacing some native herbaceous species. In the present work, we analysed seasonally the content and composition of soluble carbohydrates, the starch amounts and the above-ground biomass (phytomass) of E. inflexa and M. minutiflora plants harvested in two transects at 5 and 130 m from the border in a restrict area of cerrado at the Biological Reserve and Experimental Station of Mogi-Guaçu (SP, Brazil). Results showed that water soluble carbohydrates and starch amounts from the shoots of both species varied according to the time of the year, whilst in the underground organs, variations were observed mainly in relation to the transects. Marked differences in the pattern of the above-ground biomass production between these two grasses relative to their location in the Reserve were also observed, with two peaks of the invasive species (July and January) at the Reserve border. The differences in carbohydrate accumulation, partitioning and composition of individual sugars concerning time of the year and location in the Reserve were more related to the annual growth cycle of both grasses and possibly to specific physiological responses of M. minutiflora to disturbed environments in the Reserve border.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

CHARACTERIZATION OF MICROSATELLITE LOCI IN HIMATANTHUS DRASTICUS (APOCYNACEAE), A MEDICINAL PLANT FROM THE BRAZILIAN SAVANNA

Premise of the study: We developed a new set of microsatellite markers for studying the genome of the janaguba tree, Himatanthus drasticus (Mart.) Plumel, which is used in folk medicine in northeastern Brazil. These novel markers are being used to evaluate the effect of harvesting on the genetic structure and diversity of natural populations of this species. Methods and Results: Microsatellite loci were isolated from an enriched H. drasticus genomic library. Nine primer pairs successfully amplified polymorphic microsatellite regions, with an average of 8.5 alleles per locus. The average values of observed and expected heterozygosity were 0.456 and 0.601, respectively. Conclusions: The microsatellite markers described here are valuable tools for population genetics studies of H. drasticus. The majority of the primers also amplified sequences in the genome of another species of the same genus. This new set of markers may be useful in designing a genetic conservation strategy and a sustainable management plan for the species.

Determination of banana fruit susceptibility to post-harvest diseases: wound anthracnose, quiescent anthracnose and crown rot

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.

Biochemical characterization of pulp of banana fruit: measurement of soluble sugars, organic acids, free ACC and in vitro ACC oxidase

Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.

Assessment of the potential genotoxic risk of medicinal Tamarindus indica fruit pulp extract using in vivo assays

Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.

The Missing Part of Seed Dispersal Networks: Structure and Robustness of Bat-Fruit Interactions

Mutualistic networks are crucial to the maintenance of ecosystem services. Unfortunately, what we know about seed dispersal networks is based only on bird-fruit interactions. Therefore, we aimed at filling part of this gap by investigating bat-fruit networks. It is known from population studies that: (i) some bat species depend more on fruits than others, and (ii) that some specialized frugivorous bats prefer particular plant genera. We tested whether those preferences affected the structure and robustness of the whole network and the functional roles of species. Nine bat-fruit datasets from the literature were analyzed and all networks showed lower complementary specialization (H(2)' = 0.3760.10, mean 6 SD) and similar nestedness (NODF = 0.5660.12) than pollination networks. All networks were modular (M=0.32 +/- 0.07), and had on average four cohesive subgroups (modules) of tightly connected bats and plants. The composition of those modules followed the genus-genus associations observed at population level (Artibeus-Ficus, Carollia-Piper, and Sturnira-Solanum), although a few of those plant genera were dispersed also by other bats. Bat-fruit networks showed high robustness to simulated cumulative removals of both bats (R = 0.55 +/- 0.10) and plants (R = 0.68 +/- 0.09). Primary frugivores interacted with a larger proportion of the plants available and also occupied more central positions; furthermore, their extinction caused larger changes in network structure. We conclude that bat-fruit networks are highly cohesive and robust mutualistic systems, in which redundancy is high within modules, although modules are complementary to each other. Dietary specialization seems to be an important structuring factor that affects the topology, the guild structure and functional roles in bat-fruit networks.

The gene transformer-2 of Anastrepha fruit flies (Diptera, Tephritidae) and its evolution in insects

Background: In the tephritids Ceratitis, Bactrocera and Anastrepha, the gene transformer provides the memory device for sex determination via its auto-regulation; only in females is functional Tra protein produced. To date, the isolation and characterisation of the gene transformer-2 in the tephritids has only been undertaken in Ceratitis, and it has been shown that its function is required for the female-specific splicing of doublesex and transformer pre-mRNA. It therefore participates in transformer auto-regulatory function. In this work, the characterisation of this gene in eleven tephritid species belonging to the less extensively analysed genus Anastrepha was undertaken in order to throw light on the evolution of transformer-2. Results: The gene transformer-2 produces a protein of 249 amino acids in both sexes, which shows the features of the SR protein family. No significant partially spliced mRNA isoform specific to the male germ line was detected, unlike in Drosophila. It is transcribed in both sexes during development and in adult life, in both the soma and germ line. The injection of Anastrepha transformer-2 dsRNA into Anastrepha embryos caused a change in the splicing pattern of the endogenous transformer and doublesex pre-mRNA of XX females from the female to the male mode. Consequently, these XX females were transformed into pseudomales. The comparison of the eleven Anastrepha Transformer-2 proteins among themselves, and with the Transformer-2 proteins of other insects, suggests the existence of negative selection acting at the protein level to maintain Transformer-2 structural features. Conclusions: These results indicate that transformer-2 is required for sex determination in Anastrepha through its participation in the female-specific splicing of transformer and doublesex pre-mRNAs. It is therefore needed for the auto-regulation of the gene transformer. Thus, the transformer/transfomer-2 > doublesex elements at the bottom of the cascade, and their relationships, probably represent the ancestral state ( which still exists in the Tephritidae, Calliphoridae and Muscidae lineages) of the extant cascade found in the Drosophilidae lineage ( in which tra is just another component of the sex determination gene cascade regulated by Sex-lethal). In the phylogenetic lineage that gave rise to the drosophilids, evolution co-opted for Sex-lethal, modified it, and converted it into the key gene controlling sex determination.

A hybrid material assembled by anthocyanins from acai fruit intercalated between niobium lamellar oxide

Organic-inorganic hybrid materials can be prepared dispersing organic species into well-defined inorganic nanoblocks. This paper describes the immobilization of natural dyes from the extract of the Brazilian acai-fruit into two types of layered hexaniobate precursors derived from H(2)K(2)Nb(6)O(17): (i) colloidal dispersion of niobate exfoliated nanoparticles and (ii) niobate pre-intercalated with tetraethylammonium cations (TEA(+)). The restacking of exfoliated particles in the presence of acai anthocyanins promotes their intercalation and produces stacked layers showing large basal spacing (ca. 50 angstrom). The TEA(+) pre-intercalated niobate provides particles with lower content of dye species than the exfoliated precursor but with higher degree of organization and regularity according to X-ray diffraction data and images obtained by electron microscopies. Vibrational (FTIR and Raman) and (13)C NMR spectroscopies indicate the presence of flavylium cations in the hybrid materials and spectral profiles characteristic of glycosylated anthocyanidins. According to thermal analysis results, the purplish hybrids materials are more stable than the free acai-dyes. One hybrid sample was heated under air up to 170 degrees C and maintained at this temperature for 240 min. No weight loss events were observed and the sample retained its original color, indicating that the intercalation of anthocyanin into hexaniobate increases its thermal stability. Considering the structural, chemical, optical and thermal properties of the synthesized hybrid materials, they might be good candidates to be investigated for future specialized applications.