392 resultados para Myotonic dystrophy
Resumo:
The molecular mechanisms that coordinate cell morphogenesis with the cell cycle remain largely unknown. We have investigated this process in fission yeast where changes in polarized cell growth are coupled with cell cycle progression. The orb6 gene is required during interphase to maintain cell polarity and encodes a serine/threonine protein kinase, belonging to the myotonic dystrophy kinase/cot1/warts family. A decrease in Orb6 protein levels leads to loss of polarized cell shape and to mitotic advance, whereas an increase in Orb6 levels maintains polarized growth and delays mitosis by affecting the p34cdc2 mitotic kinase. Thus the Orb6 protein kinase coordinates maintenance of cell polarity during interphase with the onset of mitosis. orb6 interacts genetically with orb2, which encodes the Pak1/Shk1 protein kinase, a component of the Ras1 and Cdc42-dependent signaling pathway. Our results suggest that Orb6 may act downstream of Pak1/Shk1, forming part of a pathway coordinating cell morphogenesis with progression through the cell cycle.
Resumo:
Expansion of a CTG trinucleotide repeat in the 3′ untranslated region (UTR) of DMPK, the gene encoding myotonic dystrophy protein kinase, induces the dominantly inherited neuromuscular disorder myotonic dystrophy (DM). Transcripts containing the expanded trinucleotide are abundant in differentiated cultured myoblasts, and they are spliced and polyadenylylated normally. However, mutant transcripts never reach the cytoplasm in these nonmitotic cells; instead, they form stable clusters that are tightly linked to the nuclear matrix, which can prevent effective biochemical purification of these transcripts. In DM patients, reduced DMPK protein levels, consequent to nuclear retention of mutant transcripts, are probably a cause of disease development. Formation of nuclear foci is a novel mechanism for preventing transcript export and effecting a loss of gene function.
Resumo:
Myotonic dystrophy (DM) is caused by the expansion of a trinucleotide repeat, CTG, in the 3′ untranslated region of a protein kinase gene, DMPK. We set out to determine what effect this expanded repeat has on RNA processing. The subcellular fractionation of RNA and the separate analysis of DMPK transcripts from each allele reveals that transcripts from expanded DMPK alleles are retained within the nucleus and are absent from the cytoplasm of DM cell lines. The nuclear retention of DMPK transcripts occurs above a critical threshold between 80 and 400 CTGs. Further analysis of the nuclear RNA reveals an apparent reduction in the proportion of expansion-derived DMPK transcripts after poly(A)+ selection. Quantitative analysis of RNA also indicates that although the level of cytoplasmic DMPK transcript is altered in DM patients, the levels of transcripts from 59 and DMAHP, two genes that immediately flank DMPK, are unaffected in DM cell lines.
Resumo:
Myotonic dystrophy (DM) is associated with expansion of CTG repeats in the 3′-untranslated region of the myotonin protein kinase (DMPK) gene. The molecular mechanism whereby expansion of the (CUG)n repeats in the 3′-untranslated region of DMPK gene induces DM is unknown. We previously isolated a protein with specific binding to CUG repeat sequences (CUG-BP/hNab50) that possibly plays a role in mRNA processing and/or transport. Here we present evidence that the phosphorylation status and intracellular distribution of the RNA CUG-binding protein, identical to hNab50 protein (CUG-BP/hNab50), are altered in homozygous DM patient and that CUG-BP/hNab50 is a substrate for DMPK both in vivo and in vitro. Data from two biological systems with reduced levels of DMPK, homozygous DM patient and DMPK knockout mice, show that DMPK regulates both phosphorylation and intracellular localization of the CUG-BP/hNab50 protein. Decreased levels of DMPK observed in DM patients and DMPK knockout mice led to the elevation of the hypophosphorylated form of CUG-BP/hNab50. Nuclear concentration of the hypophosphorylated CUG-BP/hNab50 isoform is increased in DMPK knockout mice and in homozygous DM patient. DMPK also interacts with and phosphorylates CUG-BP/hNab50 protein in vitro. DMPK-mediated phosphorylation of CUG-BP/hNab50 results in dramatic reduction of the CUG-BP2, hypophosphorylated isoform, accumulation of which was observed in the nuclei of DMPK knockout mice. These data suggest a feedback mechanism whereby decreased levels of DMPK could alter phosphorylation status of CUG-BP/hNab50, thus facilitating nuclear localization of CUG-BP/hNab50. Our results suggest that DM pathophysiology could be, in part, a result of sequestration of CUG-BP/hNab50 and, in part, of lowered DMPK levels, which, in turn, affect processing and transport of specific subclass of mRNAs.
Resumo:
Myotonic dystrophy is caused by an expansion of a CTG triplet repeat sequence in the 3' noncoding region of a protein kinase gene, yet the mechanism by which the triplet repeat expansion causes disease remains unknown. This report demonstrates that a DNase I hypersensitive site is positioned 3' of the triplet repeat in the wild-type allele in both fibroblasts and skeletal muscle cells. In three unrelated individuals with myotonic dystrophy that have large expansions of the triplet repeat, the allele with the triplet repeat expansion exhibited both overall DNase I resistance and inaccessibility of nucleases to the adjacent hypersensitive site. These results indicate that the triplet repeat expansion alters the adjacent chromatin structure, establishing a region of condensed chromatin, and suggests a molecular mechanism for myotonic dystrophy.
Resumo:
Facioscapulohumeral muscular dystrophy (FSHD) is a progressive muscle disorder that has been associated with a contraction of 3.3-kb repeats on chromosome 4q35. FSHD is characterized by a wide clinical inter- and intrafamilial variability, ranging from wheelchair-bound patients to asymptomatic carriers. Our study is unique in comparing the gene expression profiles from related affected, asymptomatic carrier, and control individuals. Our results suggest that the expression of genes on chromosome 4q is altered in affected and asymptomatic individuals. Remarkably, the changes seen in asymptomatic samples are largely in products of genes encoding several chemokines, whereas the changes seen in affected samples are largely in genes governing the synthesis of GPI-linked proteins and histone acetylation. Besides this, the affected patient and related asymptomatic carrier share the 4qA161 haplotype. Thus, these polymorphisms by themselves do not explain the pathogenicity of the contracted allele. Interestingly, our results also suggest that the miRNAs might mediate the regulatory network in FSHD. Together, our results support the previous evidence that FSHD may be caused by transcriptional dysregulation of multiple genes, in cis and in trans, and suggest some factors potentially important for FSHD pathogenesis. The study of the gene expression profiles from asymptomatic carriers and related affected patients is a unique approach to try to enhance our understanding of the missing link between the contraction in D4Z4 repeats and muscle disease, while minimizing the effects of differences resulting from genetic background.
Resumo:
Background: The natural history of Myotonic Dystrophy type 1 is largely unclear, longitudinal studies are lacking. Objectives: to collect clinical and laboratory data, to evaluate sleep disorders, somatic and autonomic skin fibres, neuropsychological and neuroradiological aspects in DM1 patients. Methods: 72 DM1 patients underwent a standardized clinical and neuroradiological evaluation performed by a multidisciplinary team during 3 years of follow-up. Results: longer disease duration was associated with higher incidence of conduction disorders and lower ejection fraction; higher CVF values were predictors for a reduced risk of cardiopathy. Lower functional pulmonary values were associated with class of expansion and were negatively associated with disease duration; arterial blood gas parameters were not associated with expansion size, disease duration nor with respiratory function test. Excessive daytime sleepiness was not associated with class of expansion nor with any of the clinical parameters examined. We detected apnoea in a large percentage of patients, without differences between the 3 genetic classes; higher CVF values were predictors for a reduced risk of apnoea. Skin biopsies demonstrated the presence of a subclinical small fibre neuropathy with involvement of the somatic fibres. The pupillometry study showed lower pupil size at baseline and a lower constriction response to light. The most affected neuropsychological domains were executive functions, visuoconstructional, attention and visuospatial tasks, with a worse performance of E1 patients in the visuoperceptual ability and social cognition tasks. MRI study demonstrated a decrease in the volumes of frontal, parietal, temporal, occipital cortices, accumbens, putamen nuclei and a more severe volume reduction of the isthmus cingulate, transverse temporal, superior parietal and temporal gyri in E2 patients. Discussion: only some clinical parameters could predict the risk of cardiopathy, pulmonary syndrome and sleep disorders, while other clinical aspects proved to be unpredictable, confirming the importance of periodic clinical follow-up of these patients.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Os autores apresentam dois casos de distrofia miotónica em adultos jovens com compromisso cardíaco. Sublinham a raridade desta afecção, o seu envolvimento multissistémico e a dificuldade em estabelecer um diagnóstico definitivo na ausência do quadro clássico da doença.
Resumo:
ANTECEDENTES: El aislamiento de células fetales libres o ADN fetal en sangre materna abre una ventana de posibilidades diagnósticas no invasivas para patologías monogénicas y cromosómicas, además de permitir la identificación del sexo y del RH fetal. Actualmente existen múltiples estudios que evalúan la eficacia de estos métodos, mostrando resultados costo-efectivos y de menor riesgo que el estándar de oro. Este trabajo describe la evidencia encontrada acerca del diagnóstico prenatal no invasivo luego de realizar una revisión sistemática de la literatura. OBJETIVOS: El objetivo de este estudio fue reunir la evidencia que cumpla con los criterios de búsqueda, en el tema del diagnóstico fetal no invasivo por células fetales libres en sangre materna para determinar su utilidad diagnóstica. MÉTODOS: Se realizó una revisión sistemática de la literatura con el fin de determinar si el diagnóstico prenatal no invasivo por células fetales libres en sangre materna es efectivo como método de diagnóstico. RESULTADOS: Se encontraron 5,893 artículos que cumplían con los criterios de búsqueda; 67 cumplieron los criterios de inclusión: 49.3% (33/67) correspondieron a estudios de corte transversal, 38,8% (26/67) a estudios de cohortes y el 11.9% (8/67) a estudios casos y controles. Se obtuvieron resultados de sensibilidad, especificidad y tipo de prueba. CONCLUSIÓN: En la presente revisión sistemática, se evidencia como el diagnóstico prenatal no invasivo es una técnica feasible, reproducible y sensible para el diagnóstico fetal, evitando el riesgo de un diagnóstico invasivo.
Resumo:
Wydział Biologii: Instytut Biologii Molekularnej i Biotechnologii
Resumo:
Background: The myotonic dystrophy (MD) is a multisystem neuromuscular disease that can affect the respiratory muscles and heart function, and cause impairment in quality of life. Objectives: Investigate the changes in respiratory muscle strength, health-related quality of life (HRQoL) and autonomic modulation heart rate (HR) in patients with MD. Methods: Twenty-three patients performed assessment of pulmonary function, sniff nasal inspiratory pressure (SNIP), the maximal inspiratory (MIP) and expiratory (MEP) pressure, and of HRQoL (SF-36 questionnaire). Of these patients, 17 underwent assessment of heart rate variability (HRV) at rest, in the supine and seated positions. Results: The values of respiratory muscle strength were 64, 70 and 80% of predicted for MEP, MIP, and SNIP, respectively. Significant differences were found in the SF-36 domains of physical functioning (58.7 ± 31,4 vs. 84.5 ± 23, p<0.01) and physical problems (43.4 ± 35.2 vs. 81.2 ± 34, p<0.001) when patients were compared with the reference values. Single linear regression analysis demonstrated that MIP explains 29% of the variance in physical functioning, 18% of physical problems and 20% of vitality. The HRV showed that from supine position to seated, HF decreased (0.43 x 0.30), and LF (0.57 x 0.70) and the LF/HF ratio (1.28 x 2.22) increased (p< 0.05). Compared to healthy persons, LF was lower in both male patients (2.68 x 2.99) and women (2.31 x 2.79) (p< 0.05). LF / HF ratio and LF were higher in men (5.52 x 1.5 and 0.8 x 0.6, p <0.05) and AF in women (0.43 x 0.21) (p< 0.05). There was positive correlation between the time of diagnosis and LF / HF ratio (r = 0.7, p <0.01). Conclusions: The expiratory muscle strength was reduced. The HRQoL was more impaired on the physical aspects and partly influenced by changes in inspiratory muscle strength. The HRV showed that may be sympathetic dysfunction in autonomic modulation of HR, although with normal adjustment of autonomic modulation during the change of posture. The parasympathetic modulation is higher in female patients and sympathetic tends to increase in patients with longer diagnosis
Resumo:
BACKGROUND AND OBJECTIVES: Myotonic dystrophies are autosomal dominant neuromuscular diseases. Among them, myotonic dystrophy type 1 (MD1), or Steinert disease, is the most common in adults, and besides muscular involvement it also has important systemic manifestations. Myotonic dystrophy type 1 poses a challenge to the anesthesiologist. Those patients are more sensitive to anesthetics and prone to cardiac and pulmonary complications. Besides, the possibility of developing malignant hyperthermia and myotonic episodes is also present. CASE REPORT: This is a 39-year old patient with DM1 who underwent general anesthesia for videolaparoscopic cholecystectomy. Total intravenous anesthesia with propofol, remifentanil, and rocuronium was the technique chosen. Intercurrences were not observed in the 90-minute surgical procedure, but after extubation, the patient developed respiratory failure and myotonia, which made tracheal intubation impossible. A laryngeal mask was used, allowing adequate oxygenation, and mechanical ventilation was maintained until full recovery of the respiratory function. The patient did not develop further complications. CONCLUSIONS: Myotonic dystrophy type 1 presents several particularities to the anesthesiologist. Detailed knowledge of its systemic involvement along with the differentiated action of anesthetic drugs in those patients will provide safer anesthetic-surgical procedure.