961 resultados para Horn fly


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Haematobia irritans tem causado muitos danos e preocupações na pecuária mundial, bem como despertado o interesse para diversos estudos a seu respeito. Seu nome está relacionado com o local de permanência nos bovinos. É conhecida como "horn fly" (mosca-dos-chifres) na Europa e nos Estados Unidos da América e mosca-da-paleta na América Latina. Os fatores biológicos podem produzir em bovinos de um único rebanho, diferentes níveis de infestação da mosca. Durante o ano de 1998 em Araçatuba, estado de São Paulo, foram avaliados o número médio de mosca por região ana-tômica, bem como os diferentes níveis de infestação em 60 bovinos da raça Nelore. Os bovinos foram filmados de ambos os lados do corpo para registrar o número de mosca em fitas cassetes. As fitas foram assistidas para a contagem e demarcação da mosca em 15 regiões anatômicas. O maior número de mosca (p<0,05) foi observado nas regiões escapular, interescapular e costal; nos períodos chuvosos observou-se um aumento significativo (p<0,05) na região ventral. As avaliações individuais, demonstraram infestação com menos de 50 moscas em 50% dos bovinos, 50 a 100 moscas em 38% e acima de 100 moscas em 12% dos bovinos.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Blood-sucking diptera are important parasites in bovine production systems, especially regarding confinement conditions. Haematobia irritans, the horn fly, is one of the most troublesome species within bovine production systems, due to the intense stress imposed to the animals. An important aspect while studying the variability within a species is the study of the geographic structure of its populations and, attempting to find out the genetic flow of Brazilian populations of horn fly, the RAPD technique, which is suited for this purpose, has been used. The use of molecular markers generated from RAPD made it possible to identify the geographic origin of samples from different Brazilian geographic regions, as well as to estimate the genotypic flow among the different Brazilian populations of the horn fly.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Blood-sucking flies are important parasites in animal production systems, especially regarding confinement conditions. Haematobia irritans, the horn fly, is one of the most troublesome species within bovine production systems, due to the intense stress imposed to the animals. H. irritans is one of the parasites of cattle that cause significant economic losses in many parts of the world, including South America. In the present work, Brazilian, Colombian and Dominican Republic populations of this species were studied by Random Amplified Polymorphic DNA(RAPD) to assess basically genetic variability between populations. Fifteen different decamer random primers were employed in the genomic DNA amplification, yielding 196 fragments in the three H. irritans populations. Among h. irritans samples, that from Colombia produced the smallest numbers of polymorphic hands. This high genetic homogeneity may be ascribed to its geographic origin, which causes high isolation, low gene flow, unlike the other American populations, from Brazil and Dominican Republic. Molecular marker fragments, which its produced exclusive bands, detected in every sample enabled the population origin to be characterized, but they are also potentially useful for further approaches such as the putative origin of Brazilian, Colombian and Dominican Republic populations of horn fly from South America. Similarity indices produced by chemo metric analysis showed the closest relationships between flies from Brazil and Dominican Republic, while flies from Colombia showed the greatest genotypic differentiation relative to the others populations.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Muita atenção tem sido dada ao desenvolvimento de inseticidas vegetais buscando-se um efetivo controle de ectoparasitas de bovinos, sem prejudicar animais, consumidores e meio ambiente. Este estudo, realizado de abril a julho de 2008, na Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA) Pecuária Sudeste, em São Carlos, SP, Brasil, avaliou a eficácia de uma torta comercial de nim (Azadirachta indica) no controle da mosca-dos-chifres (Haematobia irritans) em bovinos. A torta de nim, misturada ao sal mineral na concentração de 2%, foi fornecida a 20 vacas Nelore, durante nove semanas, e sua eficácia foi monitorada através de contagens semanais nos grupos tratado e controle. Infestações individuais foram registradas por meio de fotos digitais em todos os animais de ambos os grupos, e o número de moscas foi, posteriormente, quantificado com o auxílio de um sistema de análise de imagem computadorizado. A quantificação dos componentes da torta de nim, por cromatografia líquida, revelou a presença de azadiractina (421 mg.kg-1) e 3-tigloyl-azadirachtol (151 mg.kg-1). A adição da torta de nim a 2% reduziu o consumo de sal mineral em cerca de 22%. O tratamento com torta de nim a 2% não reduziu as infestações por mosca-dos-chifres em bovinos durante as nove semanas do estudo.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Aiming to know the population dynamics of horn fly on cattle in the municipality of Selviria, MS, Brazil, a study was conducted from March 2004 to June 2005 in the Education, Research and Extension Farm, from Unesp - Campus de Ilha Solteira, located in the municipality of Selviria, MS. It was used IS cows of the Guzera breed and 15 crossbred (Guzera X Holstein-Friesian), respectively 3 and 4 years old, naturally infested. During the experimental period these animals did not receive any insecticide treatment. Visual fly counting by on back region of the animals was carried out at 14 day interval. The horn fly showed two peaks of infestation during the year, one in April and another in October. In the months of highest infestation, the average number of flies did not exceed a 104. The months in which was significant difference between crossbred and Guzera breed was in April, May, August and September 2004 and February, March and April 2005, always with crossbred with higher infestation. In the region studied Haematobia irritans was present throughout the year.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The laboratory production of the horn fly is still an important resource for research. Several authors have already observed that viability of immature stages varies according to arthropod species. In this study were observed the Haematobia irritans egg percentage hatching. Bovine faeces was obtained from animals grazing pastures (Brachiaria decumbens) was collected and used immediately or placed in a refrigerator (2-3 degrees C). Horn flies were captured in bovine to get eggs placed in filter paper on dung and incubate at 32 +/- 2 degrees C and 80% RH for larvae raring. The results were based on the number of hatched eggs and we observed 83,0% percent of larvae rearing.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Avaliou-se, neste experimento, a eficácia in vitro e in vivo do diflubenzuron a 25% para uso em bovinos, no controle da infestação por Haematobia irritans. Para o teste in vitro, ovos de moscas-dos-chifres foram mantidos em recipientes contendo fezes de animais não-tratados ou tratados com diflubenzuron a 25%, e acompanhados até emergência dos adultos. No teste in vivo, foram utilizadas 40 fêmeas aneloradas, divididas em dois grupos: controle (C) e tratado (T) com intensidade parasitária equivalente. Durante o experimento, o grupo C recebeu apenas suplementação mineral, enquanto o grupo T recebeu suplementação mineral e diflubenzuron a 25%. A contagem de moscas nos animais foi realizada na região dorsal, desde a nuca até as pontas da anca de cada animal, no início e ao final de um período de cinco meses. Na avaliação in vitro, o grupo controle apresentou média de emergência de 86% (± 8,4%), enquanto o grupo cultivado em fezes de bovinos tratados com diflubenzuron a 25% apresentou taxa de emergência média de 1% (± 0,2%), sendo a eficácia calculada de 98,83%. No teste in vivo, não foi observada redução significativa na contagem de moscas no grupo C, porém, no grupo T houve significativa redução da infestação por H. irritans (t = 16,46, p < 0,0001). A eficácia do produto, em condições de campo, foi de 99,20%. O diflubenzuron a 25% adicionado ao sal mineral mostrou-se eficaz contra H. irritans, sendo indicado para esse fim.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Haematobia irritans tem causado muitos danos e preocupações na pecuária mundial, bem como despertado o interesse para diversos estudos a seu respeito. Seu nome está relacionado com o local de permanência nos bovinos. É conhecida como horn fly (mosca-dos-chifres) na Europa e nos Estados Unidos da América e mosca-da-paleta na América Latina. Os fatores biológicos podem produzir em bovinos de um único rebanho, diferentes níveis de infestação da mosca. Durante o ano de 1998 em Araçatuba, estado de São Paulo, foram avaliados o número médio de mosca por região ana-tômica, bem como os diferentes níveis de infestação em 60 bovinos da raça Nelore. Os bovinos foram filmados de ambos os lados do corpo para registrar o número de mosca em fitas cassetes. As fitas foram assistidas para a contagem e demarcação da mosca em 15 regiões anatômicas. O maior número de mosca (p<0,05) foi observado nas regiões escapular, interescapular e costal; nos períodos chuvosos observou-se um aumento significativo (p<0,05) na região ventral. As avaliações individuais, demonstraram infestação com menos de 50 moscas em 50% dos bovinos, 50 a 100 moscas em 38% e acima de 100 moscas em 12% dos bovinos.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The moss Tayloria dubyi (Splachnaceae) is endemic to the subantarctic Magallanes ecoregion where it grows exclusively on bird dung and perhaps only on feces of the goose Chloephaga picta, a unique habitat among Splachnaceae. Some species of Splachnaceae from the Northern Hemisphere are known to recruit coprophilous flies as a vector to disperse their spores by releasing intense odors mimicking fresh clung or decaying corpses. The flies land on the capsule, and may get in contact with the protruding mass of spores that stick to the insect body. The dispersal strategy relies on the spores falling off when the insect reaches fresh droppings or carrion. Germination is thought to be rapid and a new population is quickly established over the entire substrate. The objectives of this investigation were to determine whether the coprophilous T. dubyi attracts flies and to assess the taxonomic diversity of the flies visiting this moss. For this, fly traps were set up above mature sporophyte bearing populations in two peatlands on Navarino Island. We captured 64 flies belonging to the Muscidae (Palpibracus chilensis), Tachinidae (Dasyuromyia sp) and Sarcophagidae (not identified to species) above sporophytes of T. dubyi, whereas no flies were captured in control traps set up above Sphagnum mats nearby.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The population density of horn flies was evaluated in the year 1998 in the municipality of Aracatuba, São Paulo Brazil, in relation to temperature and rainfall conditions. Two lots of 30 Nellore steers (Bos indicus) were used which had no insecticidal treatment and were naturally infested with horn flies. The infestations were assessed by two counting methods, i.e., the traditional estimate method and the filming method. The highest fly frequencies were recorded in spring, summer, autumn and the lowest frequencies were recorded in winter. The increase in fly number was positively correlated (P < 0.05) with rainfall. (C) 2003 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.