Ontario Tender Fruit Grower’s Marketing Board Fonds, 1960, 1967, 1969-1977, 1980-1981, 1987

The Ontario Tender Fruit Marketing Board operates under the Farm Producers Marketing Act. It covers all tender fruit farmers who produce either fresh or canned products. Today the board has over 500 grower-members. Tender fruit in the Niagara region includes: peaches, pears, plums, grapes and cherries. The fruits are used in a number of different ways, from jams and jellies to desserts, sauces and wine. Peaches were first harvested along the Niagara river in 1779. Peter Secord (Laura Secord’s uncle) is thought to be the first farmer to plant fruit trees when he took a land grant near Niagara in the mid 1780s. Since the beginnings of Secord’s farm, peaches, pears and plums have been grown in the Niagara region ever since. However, none of the original varities of peach trees remain today. Peaches were often used for more than eating by early settlers. The leaves and bark of the tree was used to make teas for conditions such as chronic bronchitis, coughs and gastritis. Cherries have been known to have anti-inflammatory and pain relieving properties. Like peaches and cherries, pears had many uses for the early pioneers. The wood was used to make furniture. The juice made excellent ciders and the leaves provided yellow dyes. Plums have been around for centuries, not only in the Niagara region, but throughout the world. They have appeared in pre-historic writings and were present for the first Thanksgiving in 1621. The grape industry in Ontario has also been around for centuries. It began in 1798 when land was granted to Major David Secord (brother-in-law to Laura Secord) slightly east of St. David’s, on what is Highway No. 8 today. Major Secord’s son James was given a part of the land in 1818 and in 1857 passed it onto Porter Adams. Adams is known to be the first person to plant grapes in Ontario1. Tender fruits are best grown in warm temperate climates. The Niagara fruit belt, stretching 65km from Hamilton to Niagara on the Lake, provides the climate necessary for this fruit production. This belt produces 90% of Ontario’s annual tender fruit crop. It is one of the largest fruit producing regions in all of Canada.

Evaluation of systems for timing of fungicide sprays for control of postbloom fruit drop of citrus in Brazil

Postbloom fruit drop (PFD) of citrus, caused by Colletotrichum acutatum, infects petals of citrus flowers and produces orange-brown lesions that induce the abscission of young fruitlets and the retention of calyces. Proper timing of fungicide applications is essential for good disease control. Different systems for timing of fungicide applications for control of PFD in a major citrus-growing region in southern São Paulo state in Brazil were evaluated from 1999 to 2002. The following programs were compared to an unsprayed control using counts of diseased flowers, persistent calyces, or fruit: (i) a phenology-based program currently recommended in Brazil with one application at early and another at peak bloom; (ii) the Florida PFD model; (iii) the postbloom fruit drop-fungicide application decision system (PFD-FAD), a new computer-assisted decision method; and (iv) grower's choice. In 1999, no disease developed, sprays applied with the phenology-based program had no effect, and the Florida PFD model saved two sprays compared with the phenology-based program. In 2000, PFD was moderate and the phenology-based and growers' choice treatments had a significantly lower number of persistent calyces and higher fruit numbers than the control, but no differences were found between those treatments and the PFD model. In 2001, PFD was severe with considerable yield loss. The PFD model, the phenology-based program, and the grower's choice reduced flower blight and the number of persistent calyces, and improved fruit yields with two to three applications, but the PFD-FAD achieved comparable yields with only one spray. In 2002, the disease was mild, with no yield loss, and the Florida PFD model and the PFD-FAD saved one spray compared with the other systems. The PFD model and the PFD-FAD were equally effective for timing fungicide applications to control PFD in Brazil. Scouting of trees is simpler with PFD-FAD; therefore, this system is recommended and should eliminate unnecessary sprays and reduce costs for growers.

Effect of training systems and pruning methods on fruit quality in apple

The introduction of dwarfed rootstocks in apple crop has led to a new concept of intensive planting systems with the aim of producing early high yield and with returns of the initial high investment. Although yield is an important aspect to the grower, the consumer has become demanding regards fruit quality and is generally attracted by appearance. To fulfil the consumer’s expectations the grower may need to choose a proper training system along with an ideal pruning technique, which ensure a good light distribution in different parts of the canopy and a marketable fruit quality in terms of size and skin colour. Although these aspects are important, these fruits might not reach the proper ripening stage within the canopy because they are often heterogeneous. To describe the variability present in a tree, a software (PlantToon®), was used to recreate the tree architecture in 3D in the two training systems. The ripening stage of each of the fruits was determined using a non-destructive device (DA-Meter), thus allowing to estimate the fruit ripening variability. This study deals with some of the main parameters that can influence fruit quality and ripening stage within the canopy and orchard management techniques that can ameliorate a ripening fruit homogeneity. Significant differences in fruit quality were found within the canopies due to their position, flowering time and bud wood age. Bi-axis appeared to be suitable for high density planting, even though the fruit quality traits resulted often similar to those obtained with a Slender Spindle, suggesting similar fruit light availability within the canopies. Crop load confirmed to be an important factor that influenced fruit quality as much as the interesting innovative pruning method “Click”, in intensive planting systems.

The Oregon grower.

Mode of access: Internet.

The Associated grower.

Mode of access: Internet.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.