1000 resultados para Appressorium development


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The 2005 National Institutes of Health (NIH) Consensus Conference proposed new criteria for diagnosing and scoring the severity of chronic graft-versus-host disease (GVHD). The 2014 NIH consensus maintains the framework of the prior consensus with further refinement based on new evidence. Revisions have been made to address areas of controversy or confusion, such as the overlap chronic GVHD subcategory and the distinction between active disease and past tissue damage. Diagnostic criteria for involvement of mouth, eyes, genitalia, and lungs have been revised. Categories of chronic GVHD should be defined in ways that indicate prognosis, guide treatment, and define eligibility for clinical trials. Revisions have been made to focus attention on the causes of organ-specific abnormalities. Attribution of organ-specific abnormalities to chronic GVHD has been addressed. This paradigm shift provides greater specificity and more accurately measures the global burden of disease attributed to GVHD, and it will facilitate biomarker association studies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

There is an urgent need to make drug discovery cheaper and faster. This will enable the development of treatments for diseases currently neglected for economic reasons, such as tropical and orphan diseases, and generally increase the supply of new drugs. Here, we report the Robot Scientist 'Eve' designed to make drug discovery more economical. A Robot Scientist is a laboratory automation system that uses artificial intelligence (AI) techniques to discover scientific knowledge through cycles of experimentation. Eve integrates and automates library-screening, hit-confirmation, and lead generation through cycles of quantitative structure activity relationship learning and testing. Using econometric modelling we demonstrate that the use of AI to select compounds economically outperforms standard drug screening. For further efficiency Eve uses a standardized form of assay to compute Boolean functions of compound properties. These assays can be quickly and cheaply engineered using synthetic biology, enabling more targets to be assayed for a given budget. Eve has repositioned several drugs against specific targets in parasites that cause tropical diseases. One validated discovery is that the anti-cancer compound TNP-470 is a potent inhibitor of dihydrofolate reductase from the malaria-causing parasite Plasmodium vivax.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

• Microsatellite primers were designed for Piptadenia gonoacantha (Fabaceae) and characterized to estimate genetic diversity parameters. The species is a native tree from the Atlantic Forest biome commonly used in forest restoration; it has medicinal potential and the wood is economically useful. • Twenty-eight microsatellite loci were identified from an enriched genomic library. Fifteen loci resulted in successful amplifications and were characterized in a natural population of 94 individuals. Twelve loci were polymorphic, with allele numbers ranging from three to 15 per locus, and expected and observed heterozygosities ranging from 0.2142 to 0.8325 and 0.190 to 0.769, respectively. • The developed markers will be used in further studies of population genetics of P. gonoacantha, aimed at conservation and management of the species in natural populations and in forest restoration projects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ropivacaine (RVC) is an aminoamide local anesthetic widely used in surgical procedures. Studies with RVC encapsulated in liposomes and complexed in cyclodextrins have shown good results, but in order to use RVC for lengthy procedures and during the postoperative period, a still more prolonged anesthetic effect is required. This study therefore aimed to provide extended RVC release and increased upload using modified liposomes. Three types of vesicles were studied: (i) large multilamellar vesicle (LMV), (ii) large multivesicular vesicle (LMVV) and (iii) large unilamellar vesicle (LUV), prepared with egg phosphatidylcholine/cholesterol/α-tocopherol (4:3:0.07 mol%) at pH 7.4. Ionic gradient liposomes (inside: pH 5.5, pH 5.5 + (NH4)2SO4 and pH 7.4 + (NH4)2SO4) were prepared and showed improved RVC loading, compared to conventional liposomes (inside: pH 7.4). An high-performance liquid chromatography analytical method was validated for RVC quantification. The liposomes were characterized in terms of their size, zeta potential, polydispersion, morphology, RVC encapsulation efficiency (EE(%)) and in vitro RVC release. LMVV liposomes provided better performance than LMV or LUV. The best formulations were prepared using pH 5.5 (LMVV 5.5in) or pH 7.4 with 250 mM (NH4)2SO4 in the inner aqueous core (LMVV 7.4in + ammonium sulfate), enabling encapsulation of as much as 2% RVC, with high uptake (EE(%) ∼70%) and sustained release (∼25 h). The encapsulation of RVC in ionic gradient liposomes significantly extended the duration of release of the anesthetic, showing that this strategy could be a viable means of promoting longer-term anesthesia during surgical procedures and during the postoperative period.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To develop Y-shaped plates with different thicknesses to be used in simulated fractures of the mandibular condyle. Ten plates were developed in Y shape, containing eight holes, and 30 synthetic polyurethane mandible replicas were developed for the study. The load test was performed on an Instron Model 4411 universal testing machine, applying load in the mediolateral and anterior-posterior positions on the head of the condyle. Two-way ANOVA with Tukey testing with a 5% significance level was used. It was observed that when the load was applied in the medial-lateral plate of greater thickness (1.5 mm), it gave the highest strength, while in the anteroposterior direction, the plate with the highest resistance was of the lesser thickness (0.6 mm). A plate with a thickness of 1.5 mm was the one with the highest average value for all displacements. In the anteroposterior direction, the highest values of resistance were seen in the displacement of 15 mm. After comparing the values of the biomechanical testing found in the scientific literature, it is suggested that the use of Y plates are suitable for use in subcondylar fractures within the limitations of the study.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Disorders of sex development (DSD) involve several conditions that result from abnormalities during gonadal determination and differentiation. Some of these disorders may manifest at birth by ambiguous genitalia; others are diagnosed only at puberty, by the delayed onset of secondary sexual characteristics. Sex determination and differentiation in humans are processes that involve the interaction of several genes such as WT1, NR5A1, NR0B1, SOX9, among others, in the testicular pathway, and WNT4, DAX1, FOXL2 and RSPO1, in the ovarian pathway. One of the major proteins in mammalian gonadal differentiation is the steroidogenic nuclear receptor factor 1 (SF1). This review will cover some of the most recent data on SF1 functional roles and findings related to mutations in its coding gene, NR5A1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This work aimed to evaluate female lineage broilers for halothane sensitivity and for their susceptibility to the subsequent development of PSE meat. The halothane test was carried out in an anesthetic chamber with 3.0% halothane. The unconscious birds were examined for leg muscle rigidity. If one or both legs became extended and rigid, the birds were classified as halothane sensitive (HAL+), while unresponsive birds were classified as halothane negative (HAL-). The results showed that of 298 birds aged 42 days old, 95.6% were HAL- and 4.4% were HAL+. A sample of pectoralis major muscle was collected from HAL- (n=105) and HAL+ (n=13) birds. The pH and breast fillet color were determined at 4ºC, 24 hours post-mortem. Interestingly, only 2.5% of HAL+ birds displayed PSE meat characteristics compared to 12.7% of HAL- individuals. The halothane test demonstrated that female lineage broilers displayed very little sensitivity towards halothane, indicating that the development of PSE meat is related to other environmental factors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of the present work was to characterize changes in the protein profile throughout seed development in O. catharinensis, a recalcitrant species, by two-dimensional gel electrophoresis. Protein extraction was undertaken by using a thiourea/urea buffer, followed by a precipitation step with 10% TCA. Comparative analysis during seed development showed that a large number of proteins were exclusively detected in each developmental stage. The cotyledonary stage, which represents the transition phase between embryogenesis and the beginning of metabolism related to maturation, presents the highest number of stage-specific spots. Protein identification, through MS/MS analysis, resulted in the identification of proteins mainly related to oxidative metabolism and storage synthesis. These findings contribute to a better understanding of protein metabolism during seed development in recalcitrant seeds, besides providing information on established markers that could be useful in defining and improving somatic embryogenesis protocols, besides monitoring the development of somatic embryos in this species.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The troglobitic armored catfish, Ancistrus cryptophthalmus (Loricariidae, Ancistrinae) is known from four caves in the São Domingos karst area, upper rio Tocantins basin, Central Brazil. These populations differ in general body shape and degree of reduction of eyes and of pigmentation. The small Passa Três population (around 1,000 individuals) presents the most reduced eyes, which are not externally visible in adults. A small group of Passa Três catfish, one male and three females, reproduced spontaneously thrice in laboratory, at the end of summertime in 2000, 2003 and 2004. Herein we describe the reproductive behavior during the 2003 event, as well as the early development of the 2003 and 2004 offsprings, with focus on body growth and ontogenetic regression of eyes. The parental care by the male, which includes defense of the rock shelter where the egg clutch is laid, cleaning and oxygenation of eggs, is typical of many loricariids. On the other hand, the slow development, including delayed eye degeneration, low body growth rates and high estimated longevity (15 years or more) are characteristic of precocial, or K-selected, life cycles. In the absence of comparable data for close epigean relatives (Ancistrus spp.), it is not possible to establish whether these features are an autapomorphic specialization of the troglobitic A. cryptophthalmus or a plesiomorphic trait already present in the epigean ancestor, possibly favoring the adoption of the life in the food-poor cave environment. We briefly discuss the current hypotheses on eye regression in troglobitic vertebrates.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Development of the positive temperature coefficient of resistivity (PTCR) in Er3+ and Ca2+ co-doped ferroelectric BaTiO3 was studied in this work, with Er3+ being used to act as a donor doping. Irrespective of all the materials showing high densities after sintering at 1200 to 1300 ºC, these revealed insulator at the lowest sintering temperature, changing to semiconducting and PTCR-type materials only when the sintering temperature was further increased. Observations from X-ray diffraction help correlating this effect with phase development in this formulated (Ba,Ca,Er)TiO3 system, considering the formation of initially two separated major (Ba,Ca)TiO3- and minor (Ca,Er)TiO3-based compounds, as a consequence of cation size-induced stress energy effects. Thus, appearance and enhancement here of the semiconducting and PTCR responses towards higher sintering temperatures particularly involve the incorporation of Er3+ into the major phase, rendering finally possible the generation and "percolative-like" migration of electrons throughout the whole material.