Neonatal enteral feeding tubes as loci for colonisation by members of the Enterobacteriaceae

Background The objective of this study was to determine whether neonatal nasogastric enteral feeding tubes are colonised by the opportunistic pathogen Cronobacter spp. (Enterobacter sakazakii) and other Enterobacteriaceae, and whether their presence was influenced by the feeding regime. Methods One hundred and twenty-nine tubes were collected from two neonatal intensive care units (NICU). A questionnaire on feeding regime was completed with each sample. Enterobacteriaceae present in the tubes were identified using conventional and molecular methods, and their antibiograms determined. Results The neonates were fed breast milk (16%), fortified breast milk (28%), ready to feed formula (20%), reconstituted powdered infant formula (PIF, 6%), or a mixture of these (21%). Eight percent of tubes were received from neonates who were 'nil by mouth'. Organisms were isolated from 76% of enteral feeding tubes as a biofilm (up to 107 cfu/tube from neonates fed fortified breast milk and reconstituted PIF) and in the residual lumen liquid (up to 107 Enterobacteriaceae cfu/ml, average volume 250 µl). The most common isolates were Enterobacter cancerogenus (41%), Serratia marcescens (36%), E. hormaechei (33%), Escherichia coli (29%), Klebsiella pneumoniae (25%), Raoultella terrigena (10%), and S. liquefaciens (12%). Other organisms isolated included C. sakazakii (2%),Yersinia enterocolitica (1%),Citrobacter freundii (1%), E. vulneris (1%), Pseudomonas fluorescens (1%), and P. luteola (1%). The enteral feeding tubes were in place between < 6 h (22%) to > 48 h (13%). All the S. marcescens isolates from the enteral feeding tubes were resistant to amoxicillin and co-amoxiclav. Of additional importance was that a quarter of E. hormaechei isolates were resistant to the 3rd generation cephalosporins ceftazidime and cefotaxime. During the period of the study, K. pneumoniae and S. marcescens caused infections in the two NICUs. Conclusion This study shows that neonatal enteral feeding tubes, irrespective of feeding regime, act as loci for the bacterial attachment and multiplication of numerous opportunistic pathogens within the Enterobacteriaceae family. Subsequently, these organisms will enter the stomach as a bolus with each feed. Therefore, enteral feeding tubes are an important risk factor to consider with respect to neonatal infections.

The colonisation of non-sterile wheat straw by fungi

DUE TO COPYRIGHT RESTRICTIONS ONLY AVAILABLE FOR CONSULTATION AT ASTON UNIVERSITY LIBRARY AND INFORMATION SERVICES WITH PRIOR ARRANGEMENT

Ecological studies on:(a) the use of colonisation samplers in relation to biological surveillance of river water quality (b) the requirements of freshwater gastropoda

Some of the factors affecting colonisation of a colonisation sampler, the Standard Aufwuchs Unit (S. Auf. U.) were investigated, namely immersion period, whether anchored on the bottom or suspended, and the influence of riffles. It was concluded that a four-week immersion period was best. S. Auf. U. anchored on the bottom collected both more taxa and individuals than suspended ones. Fewer taxa but more individuals colonised S. Auf. U. in the potamon zone compared to the rhithron zone with a consequent reduction in the values of pollution indexes and diversity. It was concluded that a completely different scoring system was necessary for lowland rivers. Macroinvertebrates colonising S. Auf. U. in simulated streams, lowland rivers and the R. Churnet reflected water quality. A variety of pollution and diversity indexes were applied to results from lowland river sites. Instead of these, it was recommended that an abbreviated species - relative abundance list be used to summarise biological data for use in lowland river surveillance. An intensive study of gastropod populations was made in simulated streams. Lynnaea peregra increased in abundance whereas Potamopyrgas jenkinsi decreased with increasing sewage effluent concentration. No clear-cut differences in reproduction were observed. The presence/absence of eight gastropod taxa was compared with concentrations of various pollutants in lowland rivers. On the basis of all field work it appeared that ammonia, nitrite, copper and zinc were the toxicants most likely to be detrimental to gastropods and that P. jenkinsi and Theodoxus fluviatilis were the least tolerant taxa. 96h acute toxicity tests of P. jenkinsi using ammonia and copper were carried out in a flow-through system after a variety of static range finding tests. P. jenkinsi was intolerant to both toxicants compared to reports on other taxa and the results suggested that these toxicants would affect distribution of this species in the field.

Anti-bacterial skin disinfectants in the reduction of methicillin resistant staphylococcus aureus (MRSA) skin colonisation

DUE TO COPYRIGHT RESTRICTIONS ONLY AVAILABLE FOR CONSULTATION AT ASTON UNIVERSITY LIBRARY AND INFORMATION SERVICES WITH PRIOR ARRANGEMENT

Microbialites and lipid biomarker from coral reefs off the volcanic islands Tahiti and Vanuatu and from the nonvolcanic sites Belize and the Maldives

The occurrence of microbialites in post-glacial coral reefs has been interpreted to reflect an ecosystem response to environmental change. The greater thickness of microbialites in reefs with a volcanic hinterland compared to thinner microbial crusts in reefs with a non-volcanic hinterland led to the suggestion that fertilization of the reefal environment by chemical weathering of volcanic rocks stimulated primary productivity and microbialite formation. Using a molecular and isotopic approach on reef-microbialites from Tahiti (Pacific Ocean), it was recently shown that sulfate-reducing bacteria favored the formation of microbial carbonates. To test if similar mechanisms induced microbialite formation in other reefs as well, the Tahitian microbialites are compared with similar microbialites from coral reefs off Vanuatu (Pacific Ocean), Belize (Caribbean Sea, Atlantic Ocean), and the Maldives (Indian Ocean) in this study. The selected study sites cover a wide range of geological settings, reflecting variable input and composition of detritus. The new lipid biomarker data and stable sulfur isotope results confirm that sulfate-reducing bacteria played an intrinsic role in the precipitation of microbial carbonate at all study sites, irrespective of the geological setting. Abundant biomarkers indicative of sulfate reducers include a variety of terminally-branched and mid chain-branched fatty acids as well as mono-O-alkyl glycerol ethers. Isotope evidence for bacterial sulfate reduction is represented by low d34S values of pyrite (-43 to -42 per mill) enclosed in the microbialites and, compared to seawater sulfate, slightly elevated d34S and d18O values of carbonate-associated sulfate (21.9 to 22.2 per mill and 11.3 to 12.4 per mill, respectively). Microbialite formation took place in anoxic micro-environments, which presumably developed through the fertilization of the reef environment and the resultant accumulation of organic matter including bacterial extracellular polymeric substances (EPS), coral mucus, and marine snow in cavities within the coral framework. ToF-SIMS analysis reveals that the dark layers of laminated microbialites are enriched in carbohydrates, which are common constituents of EPS and coral mucus. These results support the hypothesis that bacterial degradation of EPS and coral mucus within microbial mats favored carbonate precipitation. Because reefal microbialites formed by similar processes in very different geological settings, this comparative study suggests that a volcanic hinterland is not required for microbialite growth. Yet, detrital input derived from the weathering of volcanic rocks appears to be a natural fertilizer, being conductive for the growth of microbial mats, which fosters the development of particularly abundant and thick microbial crusts.

Tropical cyclone perceptions, impacts and adaptation in the Southwest Pacific: an urban perspective from Fiji, Vanuatu and Tonga

The destruction caused by tropical cyclone (TC) Pam in March 2015 is considered one of the worst natural disasters in the history of Vanuatu. It has highlighted the need for a better understanding of TC impacts and adaptation in the Southwest Pacific (SWP) region. Therefore, the key aims of this study are to (i) understand local perceptions of TC activity, (ii) investigate impacts of TC activity and (iii) uncover adaptation strategies used to offset the impacts of TCs. To address these aims, a survey (with 130 participants from urban areas) was conducted across three SWP small island states (SISs): Fiji, Vanuatu and Tonga (FVT). It was found that respondents generally had a high level of risk perception and awareness of TCs and the associated physical impacts, but lacked an understanding of the underlying weather conditions. Responses highlighted that current methods of adaptation generally occur at the local level, immediately prior to a TC event (preparation of property, gathering of food, finding a safe place to shelter). However higher level adaptation measures (such as the modification to building structures) may reduce vulnerability further. Finally, we discuss the potential
of utilising weather-related traditional knowledge and nontraditional knowledge of empirical and climate-model-based weather forecasts to improve TC outlooks, which would ultimately reduce vulnerability and increase adaptive capacity. Importantly, lessons learned from this study may result in the modification and/or development of existing adaptation strategies.

The status of weed biological control in Vanuatu

Biological control of weeds in Vanuatu began in 1935, with the introduction of the tingid Teleonemia scrupulosa to control Lantana camara. To date, nine biological control agents have been intentionally introduced to control eight weed species. Seven of these agents have established on their respective hosts while an eighth, Zygogramma bicolorata, an agent for Parthenium hysterophorus has only recently been released and establishment is unlikely. The fate of a ninth agent, Heteropsylla spinulosa, released for the control of Mimosa diplotricha is unclear. Six other biological control agents, including Epiblema strenuana which was first detected in 2014 on P. hysterophorus on Efate have spread into the country unintentionally. Control of the target weeds range from inadequate to very good. By far the most successful agent has been Calligrapha pantherina which was introduced to control Sida acuta and Sida rhombifolia. The beetle was released on 14 islands and managed to spread to at least another 10 islands where it has effectively controlled both Sida spp. Control of the two water weeds, Eichhornia crassipes by Neochetina bruchi and N. eichhorniae and Pistia stratiotes by Neohydronomus affinis, has also been fairly good in most areas. Two agents, T. scrupulosa and Uroplata girardi, were released on L. camara, and four other agents have been found on the weed, but L. camara is still not under adequate control. The rust Puccinia spegazzinii was first released on Mikania micrantha in 2012 and successfully established. Anecdotal evidence suggests that it is having an impact on M. micrantha, but detailed monitoring is required to determine its overall impact. Future prospects for weed biological control in Vanuatu are positive, with the expected greater spread of recently released agents and the introduction of new agents for P. hysterophorus, L. camara, Dolichandra unguis-cati and Spathodea campanulata.

Xanten-Vetera - Analyse et caractérisation du processus de colonisation et de romanisation d’une région frontalière en Germanie inférieure

Ce mémoire analyse le processus de romanisation et de colonisation de Xanten-Vetera, une région frontalière de l’Empire romain située en basse Rhénanie dans la province romaine de Germania inferior. À l’intérieur d’un cadre temporel inclus entre les conquêtes de Jules César et le milieu du second siècle apr. J.-C., l’étude cherche à comprendre et à restituer la présence militaire ainsi que le développement des peuplades civiles sur place, du fait des transferts de population et de l’immigration gallo-romaine. Le processus de romanisation est analysé en tenant compte des réalités ethnographiques, sociales et culturelles et selon les théories les plus actuelles de la recherche moderne sur ce sujet. Comme il s’agit d’une agglomération située sur une voie fluviale en périphérie de l’Empire, le concept de « frontière » y est évalué afin d’estimer si Xanten-Vetera constituait une zone de convergence ou de divergence par rapport à l’espace rhénan. Dans un deuxième temps, cette recherche analyse le contexte militaire et social durant lequel l’empereur Trajan prit la décision d’octroyer le statut de colonie à ce territoire qui devint la Colonia Ulpia Traiana. Cette démarche qui se veut régionale souligne la nature particulière de l’histoire de Xanten-Vetera sous le Haut Empire ; les migrations et les tragédies à l’intérieur de cet espace géographique ont façonné un endroit au destin unique en Germanie et dans l’Empire romain. Enfin, ce travail fournit un exemple pertinent de l’évolution des motivations qui ont guidé les politiques coloniales sous les Julio-Claudiens, les Flaviens et les Antonins et suggère l’essor des groupes de pression non militaires dans ce contexte.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Osmoregulation of the Australian freshwater crocodile, Crocodylus johnstoni, in fresh and saline waters

An unusual saltwater population of the "freshwater" crocodilian, Crocodylus johnstoni, was studied in the estuary of the Limmen Bight River in Australia's Northern Territory and compared with populations in permanently freshwater habitats. Crocodiles in the river were found across a large salinity gradient, from fresh water to a salinity of 24 mg.ml-1, more than twice the body fluid concentration. Plasma osmolarity, concentrations of plasma Na+, Cl-, and K+, and exchangeable Na+ pools were all remarkably constant across the salinity spectrum and were not substantially higher or more variable than those in crocodiles from permanently freshwater habitats. Body fluid volumes did not vary; condition factor and hydration status of crocodiles were not correlated with salinity and were not different from those of crocodiles from permanently fresh water. C. johnstoni clearly has considerable powers of osmoregulation in waters of low to medium salinity. Whether this osmoregulatory competence, extends to continuously hyperosmotic environments is not known, but distributional data suggest that C. johnstoni in hyperosmotic conditions may require periodic access to hypoosmotic water. The study demonstrates a physiological capacity for colonisation of at least some estuarine waters by this normally stenohaline freshwater crocodilian.

Acute susceptibility of aged mice to infection with Candida albicans

The effect of aging on host resistance to systemic candidosis was assessed by monitoring the course of infection in 16-month-old CBA/CaH mice (aged non-immune) and in a comparable group that had been infected with a sublethal dose of Candida albicans at 6 weeks of age (aged immune). Aged non-immune mice showed rapid progression of the disease, with a marked increase in the number of mycelia in the brain and kidney, and early morbidity, Foci of myocardial necrosis were evident, but inflammatory cells were sparse. The histological picture in the aged immune mice was similar to that in the aged non-immune group, although fewer mycelial aggregates were seen. Both groups of aged mice showed a significantly lower fungal burden in the brain on day 1 of infection, but on day 4, colony counts increased significantly in the aged non-immune mice, Comparison of cytokine gene expression in the infected brains showed that the relative amount of interferon-gamma and tumour necrosis factor-alpha cDNA were similar in all three groups. Interleukin-6 was elevated in both infected non-immune and uninfected aged mice. Aged immune mice showed no morbidity after challenge, and both colonisation and tissue damage were reduced in comparison with the aged non-immune animals.