PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Yield, changes in proteolysis, and sensory quality of Prato cheese produced with different coagulants

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Development of a method for sampling and determination of corrosion inhibitors in modified atmospheres

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Análise quimico-farmacêutica de Darunavir etanolato em comprimidos e de seu complexo de inclusão

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Purificação e estudos bioquímicos de exo-poligalacturonase (pectinase) produzida pelo fungo termofílico Rhizomucor pusillus, em cultivo submerso e aplicação na extração de sucos de frutas e hidrólise enzimática do bagaço de cana-de-açúcar

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Systematic Evaluation of Extraction Methods for Multiplatform-Based Metabotyping: Application to the Fasciola hepatica Metabolome

Combining data from multiple analytical platforms is essential for comprehensive study of the molecular phenotype (metabotype) of a given biological sample. The metabolite profiles generated are intrinsically dependent on the analytical platforms, each requiring optimization of instrumental parameters, separation conditions, and sample extraction to deliver maximal biological information. An in-depth evaluation of extraction protocols for characterizing the metabolome of the hepatobiliary fluke Fasciola hepatica, using ultra performance liquid chromatography and capillary electrophoresis coupled with mass spectroscopy is presented. The spectrometric methods were characterized by performance, and metrics of merit were established, including precision, mass accuracy, selectivity, sensitivity, and platform stability. Although a core group of molecules was common to all methods, each platform contributed a unique set, whereby 142 metabolites out of 14,724 features were identified. A mixture design revealed that the chloroform:methanol:water proportion of 15:59:26 was globally the best composition for metabolite extraction across UPLC-MS and CE-MS platforms accommodating different columns and ionization modes. Despite the general assumption of the necessity of platform-adapted protocols for achieving effective metabotype characterization, we show that an appropriately designed single extraction procedure is able to fit the requirements of all technologies. This may constitute a paradigm shift in developing efficient protocols for high-throughput metabolite profiling with more-general analytical applicability.

LIQUID-PHASE MICROEXTRACTION FOR SIMULTANEOUS CHROMATOGRAPHIC ANALYSIS OF THREE ANTIDEPRESSANT DRUGS IN PLASMA

A method using Liquid Phase Microextraction for simultaneous detection of citalopram (CIT), paroxetine (PAR) and fluoxetine (FLU), using venlafaxine as internal standard, in plasma by high performance liquid chromatography with fluorescence detection was developed. The linearity was evaluated between 5.0 and 500 ng mL(-1) (r > 0.99) and the limit of quantification was 2.0, 3.0 and 5.0 ng mL-1 for CIT. PAR and FLU, respectively. Therefore, it can be applied to therapeutic drug monitoring, pharmacokinetics or bioavailability studies and its advantages are that it necessary relatively inexpensive equipment and sample preparation techniques.

Fast Determination of Ciclopirox in Pharmaceutical Products by Amperometry in Flow and Batch Injection Systems

Amperometry coupled to flow injection analysis (FIA) and to batch injection analysis (BIA) was used for the rapid and precise quantification of ciclopirox olamine in pharmaceutical products. The favourable hydrodynamic conditions provided by both techniques allowed a very high throughput (more than 300 injections per hour) with good linear range (2.0200 mu mol L-1) and low limits of detection (below 1.0 mu mol?L-1). The results obtained were compared with titration recommended by the American Pharmacopoeia and also using capillary electrophoresis. Good agreement between all results were achieved, demonstrating the good performance of amperometry combined with FIA and BIA.

On the formation of carbonate adducts of fatty alcohols, sterols, and sugars in biological conditions

The formation and properties of carbonate adducts of some organic hydroxy compounds in aqueous medium were investigated. Fatty alcohols and sugars were chosen as representative classes of biological interest, and the medium was carbonated aqueous solution with pH ranging from 3.0 to 8.3. Capillary electrophoresis with two capacitively coupled contactless conductivity detectors (C4Ds) was used for quantitation and to obtain the mobility of the monoalkyl carbonates (MACs), which were used to determine the equilibrium and kinetic constants of the reaction as well as the diffusion coefficients. For increasing chain length of the alcohols, the equilibrium constant tends to the unit, which suggests that fatty alcohols can form the corresponding MACs. The formation of MACs for cyclohexanol and cyclopentanol also suggest the existence of similar species for sterols. Carbonate adducts of fructose, glucose, and sucrose were also detected, which suggests that these counterparts of the well-known phosphates can also occur in the cytosol. Our calculations suggest that one in 1000 to one in 10 000 molecules of these hydroxy compounds would be available as the corresponding MAC in such a medium. Experiments carried out at pH values less than 3.0 showed that there is a catalytic effect of hydronium on the interconversion of bicarbonate and a MAC. Taking into account the great number of hydroxy compounds similar to the ones investigated and that bicarbonate is ubiquitous in living cells, one can anticipate the existence of a whole new class of carbonate adducts of these metabolites.

Assessment of the stereoselective fungal biotransformation of albendazole and its analysis by HPLC in polar organic mode

A high-performance liquid chromatographic method using polar organic mode was developed to analyze albendazole (ABZ), albendazole sulfone (ABZSO(2)) and the chiral and active metabolite albendazole sulfoxide (ABZSOX, ricobendazole) that was further applied in stereoselective fungal biotransformation studies. The chromatographic separation was performed on a Chiralpak AS column using acetonitrile:ethanol (97:3, v/v) plus 0.2% triethylamine and 0.2% acetic acid as the mobile phase at a flow rate of 0.5 mL min(-1). The present study employed hollow fiber liquid-phase microextraction as sample preparation. The method showed to be linear over the concentration range of 25-5000 ng mL(-1) for each ABZSOX enantiomer, 200-10,000 ng mL(-1) for ABZ and 50-1000 ng mL(-1) for ABZSO(2) metabolite with correlation coefficient (r)> 0.9934. The mean recoveries for ABZ, rac-ABZSOX and ABZSO(2) were, respectively, 9%, 33% and 20% with relative standard deviation below 10%. Within-day and between-day precision and accuracy assays for these analytes were studied at three concentration levels and were lower than 15%. This study opens the door regarding the possibility of using fungi in obtaining of the active metabolite ricobendazole. Nigrospora sphaerica (Sacc.) E. W. Mason (5567), Pestalotiopsis foedans (VR8), Papulaspora immersa Hotson (SS13) and Mucor rouxii were able to stereoselectively metabolize ABZ into its chiral metabolite. Among them, the fungus Mucor rouxii was the most efficient in the production of (+)-ABZSOX. (C) 2011 Elsevier B.V. All rights reserved.

Sensitive and fast determination of Sudan dyes in chilli powder by partial-filling micellar electrokinetic chromatography-tandem mass spectrometry

A fast and sensitive method for the simultaneous determination of Sudan dyes (I, II, III, and IV) in food samples was developed for the first time using partial filling micellar electrokinectic chromatography-mass spectrometry (MEKC-MS). The use of MEKC was essential to achieve the separation of these neutral analytes, while the partial filling technique was necessary to avoid the contamination of the ion source with non-volatile micelles. MEKC separation and MS detection conditions were optimized in order to achieve a fast, efficient, and sensitive separation of the four dyes. Filling 25% of the capillary with an MEKC solution containing 40 mM ammonium bicarbonate, 25 mM SDS, and 32.5% (v/v) acetonitrile, a baseline separation of the four azo-dyes was obtained in 10 min. Tandem MS was investigated in order to improve the sensitivity and selectivity of the analysis. Limits of detection (LOD) values 5, 8, 15, and 29 times better were obtained for Sudan III, I, II, and IV, respectively, using partial filling MEKC-MS/MS instead of partial filling MEKC-MS. Under optimized conditions, LOD from 0.05 to 0.2 mu g/mL were obtained. The suitability of the developed method was demonstrated through the fast and sensitive determination of Sudan I, II, III, and IV in spiked chilli powder samples. This determination could not be achieved by MEKC-UV due to the existence of several interfering compounds from the matrix.

Analysis of carvedilol enantiomers in human plasma using chiral stationary phase column and liquid chromatography with tandem mass spectrometry

Carvedilol is an antihypertensive drug available as a racemic mixture. (-)-(S)-carvedilol is responsible for the nonselective beta-blocker activity but both enantiomers present similar activity on a1-adrenergic receptor. To our knowledge, this is the first study of carvedilol enantiomers in human plasma using a chiral stationary phase column and liquid chromatography with tandem mass spectrometry. The method involves plasma extraction with diisopropyl ether using metoprolol as internal standard and direct separation of the carvedilol enantiomers on a Chirobiotic T (R) (Teicoplanin) column. Protonated ions [M + H]+ and their respective ion products were monitored at transitions of 407 > 100 for the carvedilol enantiomers and 268 > 116 for the internal standard. The quantification limit was 0.2 ng ml-1 for both enantiomers in plasma. The method was applied to study enantioselectivity in the pharmacokinetics of carvedilol administered as a single dose of 25 mg to a hypertensive patient. The results showed a higher plasma concentration of (+)-(R)-carvedilol (AUC08 205.52 vs. 82.61 (ng h) ml-1), with an enantiomer ratio of 2.48. Chirality, 2012. (C) 2012 Wiley Periodicals, Inc.

Solid phase microextraction and LC-MS/MS for the determination of paliperidone after stereoselective fungal biotransformation of risperidone

The present work describes for the first time the use of SPME coupled to LC-MS/MS employing the polar organic mode in a stereoselective fungal biotransformation study to investigate the fungi ability to biotransform the drug risperidone into its chiral and active metabolite 9-hydroxyrisperidone (9-RispOH). The chromatographic separation was performed on a Chiralcel OJ-H column using methanol:ethanol (50:50, v/v) plus 0.2% triethylamine as the mobile phase at a flow rate of 0.8 mL min(-1). The SPME process was performed using a C18 fiber, 30 min of extraction time and 5 min of desorption time in the mobile phase. The method was completely validated and all parameters were in agreement with the literature recommendations. The Cunninghamella echinulata fungus was able to biotransform risperidone into the active metabolite, (+)-9-RispOH, resulting in 100% of enantiomeric excess. The Cunninghamella elegans fungus was also able to stereoselectively biotransform risperidone into (+)- and (-)-9-RispOH enantiomers at different rates. (C) 2012 Elsevier B.V. All rights reserved.

Correlations of CTLA-4 gene polymorphisms and hepatitis C chronic infection

Background: Cytotoxic T lymphocyte-associated factor 4 (CTLA-4) functions as a negative regulator of T cell-mediated immune response. Molecular changes associated to CTLA-4 gene polymorphisms could reduce its ability to suppress and control lymphocyte proliferation. Aims: To evaluate the frequency of CTLA-4 gene polymorphisms in chronic hepatitis C virus (HCV) infected patients and correlate to clinical and histological findings. Methods: We evaluated 112 HCV-infected subjects prospectively selected and 183 healthy controls. Clinical and liver histological data were analysed. - 318C > T, A49G and CT60 CTLA-4 single-nucleotide polymorphisms (SNPs) were studied by PCR-RFLP and AT(n) polymorphism by DNA fragment analysis by capillary electrophoresis in automatic sequencer. Results: Eight AT repetitions in 3' UTR region were more frequent in HCV-infected subjects. We found a positive association of -318C and + 49G with HCV genotype 3 (P = 0.008, OR 9.13, P = 0.004, OR 2.49 respectively) and an inverse association of both alleles with HCV genotype 1 (P = 0.020, OR 0.19, P = 0.002, OR 0.38 respectively). Allele + 49G was also associated to aminotransferases quotients > 3 (qALT, P = 0.034, qAST, P = 0.041). Allele G of CT60 SNP was also associated with qAST > 3 (P = 0.012). Increased number of AT repetitions was positively associated to severe necroinflammatory activity scores in liver biopsies (P = 0.045, OR 4.62). Conclusion: CTLA-4 gene polymorphisms were associated to HCVinfection. Eight AT repetitions were more prevalent in HCV-infected subjects. - 318C and + 49G alleles were associated to genotypes 1 and 3 infections and increased number of AT repetitions in 3' UTR region favoured severe necroinflammatory activity scores in liver biopsies.

Monoalkyl carbonates in carbonated alcoholic beverages

The presence of monoethyl carbonate (MEC) in beer and sparkling wine is demonstrated for the first time, as well as the formation of this species in drinks prepared with a distilled beverage and a carbonated soft drink. A capillary electrophoresis (CE) equipment with two capacitively coupled contactless conductivity detector ((CD)-D-4) was used to identify and quantify this species. The concentrations of MEC in samples of lager beer and rum and cola drink were, respectively, 1.2 and 4.1 mmol/l, which agree with the levels of ethanol and CO2 available in these products. Previous results about the kinetics of the reaction suggest that only a small amount of MEC should be formed after the ingredients of a drink are mixed. However, in all three cases (whisky and club soda: rum with cola; gin and tonic water), MEC was quickly formed, which was attributed to the low pH of the drinks. (C) 2012 Elsevier Ltd. All rights reserved.