Array-CGH testing in spontaneous abortions with normal karyotypes

In about 50% of first trimester spontaneous abortion the cause remains undetermined after standard cytogenetic investigation. We evaluated the usefulness of array-CGH in diagnosing chromosome abnormalities in products of conception from first trimester spontaneous abortions. Cell culture was carried out in short- and long-term cultures of 54 specimens and cytogenetic analysis was successful in 49 of them. Cytogenetic abnormalities (numerical and structural) were detected in 22 (44.89%) specimens. Subsequent, array-CGH based on large insert clones spaced at ~1 Mb intervals over the whole genome was used in 17 cases with normal G-banding karyotype. This revealed chromosome aneuplodies in three additional cases, giving a final total of 51% cases in which an abnormal karyotype was detected. In keeping with other recently published works, this study shows that array-CGH detects abnormalities in a further ~10% of spontaneous abortion specimens considered to be normal using standard cytogenetic methods. As such, array-CGH technique may present a suitable complementary test to cytogenetic analysis in cases with a normal karyotype.

PAH biomarkers for human health risk assessment: a review of the state-of-the-art

Polycyclic aromatic hydrocarbons (PAH) are widely distributed in the environment, and some are carcinogenic to human beings. The study of biomarkers has helped clarify the nature and magnitude of the human health risks posed by such substances. This article provides a review of the state-of-the-art on PAH biomarkers for human health risk assessment and also discusses their applicability within the context of environmental management in Brazil. The article discusses the methodologies for determination of some biomarkers such as 1-hydroxypyrene and PAH-DNA adducts. Cytogenetic markers, frequency of chromosomal aberrations, and micronucleus induction were considered for the evaluation of cancer risk. The current stage of studies on validation of such biomarkers was also approached.

Ring chromosome instability evaluation in six patients with autosomal rings

Ring chromosomes are often associated with abnormal phenotypes due to loss of genomic material and also because of ring instability at mitosis after sister chromatid exchange events. We investigated ring chromosome instability in six patients with ring chromosomes 4, 14, 15, and 18 by examining 48- and 72-h lymphocyte cultures at the first, second and subsequent cell divisions after bromodeoxyuridine incorporation. Although most cells from all patients showed only one monocentric ring chromosome, ring chromosome loss and secondary aberrations were observed both in 48-and 72-h lymphocyte cultures and in metaphase cells of the different cell generations. We found no clear-cut correlation between ring size and ring instability; we also did not find differences between apparently complete rings and rings with genetic material loss. The cytogenetic findings revealed secondary aberrations in all ring chromosome patients. We concluded that cells with ring chromosome instability can multiply and survive in vivo, and that they can influence the patient's phenotype.

Tetraploidization in Wilms tumor in an infant

Genetic instability is frequent in human cancer. Unscheduled tetraploidization can trigger cell transformation and tumorigenesis. We made a cytogenetic analysis by Giemsa-trypsin banding of a stage I, biphasic Wilms tumor diagnosed in a 10-month-old male. An evident karyotypic heterogeneity was found. Four different subclones of tumor cells were observed, with DNA content varying from diploid to near-tetraploid complements. The genetic events involved in the acquisition of aneuploidy in Wilms tumor remain unclear. We hypothesize that initial tetraploidization caused aberrant cell division, leading to abnormal chromosomal segregation, cell transformation and tumorigenesis.

Karyotypic evolution trends in Rhamdia quelen (Siluriformes, Heptapteridae) with considerations about the origin and differentiation of its supernumerary chromosomes

Among catfish species of the genus Rhamdia reported for the Brazilian territory, R. quelen is the most widespread, being found in nearly all hydrographic basins of Brazil. Nowadays, R. quelen is a synonym for at least 47 other species in this genus, its taxonomic status still being controversial. The available cytogenetic reports show a wide variation in the karyotypic macrostructure, with the frequent presence of supernumerary chromosomes. The remarkable cytogenetic variability associated with taxonomic issues in this species indicates that R. quelen is actually a species complex. In order to carry out a wide comparative cytogenetic study in R. quelen from southern and southeastern Brazil and examine a species complex, we analyzed the chromosomes of 14 populations from the main hydrographic basins of these two regions. Using classic and molecular cytogenetic techniques, we found seven distinct karyotypic formulae, all bearing 2n = 58 chromosomes. Supernumerary chromosomes were present in most of the populations; their number, size and C-banding pattern allowed us to differentiate populations with similar karyotypic compositions. We examined patterns of chromosomal evolution as well as the probable mechanisms involved in the origin and morphological differentiation of their supernumerary chromosomes.

Sensitivity to cisplatin-induced mutations and elevated chromosomal aberrations in lymphocytes from sickle cell disease patients

Sickle cell disease (SCD) is an inherited disorder caused by a single nucleotide substitution in the P-globin gene. The clinical heterogeneity observed in SCD patients has been attributed to environmental and genetic factors. The patients are subjected to increased oxidative stress, particularly during vaso-occlusive crises and acute chest pain. Another possible cause of oxidative stress in SCD is the high concentration of iron in the patients` plasma. The increase in oxidative stress could be a relevant risk factor for mutagenesis and carcinogenesis. Studies on the frequency of basal chromosomal aberrations in cultured lymphocytes from SCD patients have not been reported so far. In order to contribute to the understanding of the role of the different biomarkers and their relationship with the extremely variable clinical manifestation of SCD, we investigated the frequency of chromosome damage in peripheral lymphocytes from sickle cells patients and healthy controls. We found an increased frequency of chromosome damage and percentage of aberrant metaphases in these patients when compared with control subjects, even at basal values (p < 0.05). In the cytogenetic sensitivity assay, the results showed that these patients presented a marked decrease in the mitotic index values compared with healthy controls. Cisplatin-induced chromosomal damage in lymphocytes from these patients was significantly higher than the frequency measured in healthy controls. The results obtained in the present study showed that more investigations are needed in order to elucidate the susceptibility to genomic instability of SCD patients.

Evaluation of the genotoxicity of Crotalus durissus terrificus snake venom and its isolated toxins on human lymphocytes

In the present study, experiments were carried out to evaluate the mutagenic potential and genotoxic effects of Crotalus durissus terrificus snake venom and its isolated toxins on human lymphocytes, using the micronucleus and comet assays. Significant damage to DNA was observed for crotoxin and crotapotin (CA). Basic phospholipase A(2) (CB) and crotamine did not present any mutagenic potential when evaluated by the micronucleus test. C. d. terrificus crude venom was able to induce the formation of micronuclei, similarly to the mutagenic drug used as a positive control. In the comet assay, all the toxins tested (crotamine, crotoxin, CB and CA) and C. d. terrificus venom presented genotoxic activity. Studies on the cytogenetic toxicology of animal venoms and their isolated proteins are still very scarce in the literature, which emphasizes the importance of the present work for the identification and characterization of potential therapeutic agents, as well as for the better understanding of the mechanisms of action of toxins on the human body. (C) 2011 Elsevier B.V. All rights reserved.

Genotoxic studies in hypertensive and normotensive rats treated with amiodarone

Amiodarone, a benzofuran derivative. is a very effective antiarrhythmic medication, but has potential to cause side effects. Although its cytotoxicity potential is very well-known, there are few reports about its genotoxicity effects. Since amiodarone has not been investigated in genotoxicity studies, and the spontaneously hypertensive rat (SHR) is a well-characterized model for hypertension, the aim of the present study was to perform cytogenetic analysis on chromosome aberrations in bone marrow cells of SHRs and normotensive Wistar-Kyoto rats (WKYs) that received oral amiodarone treatment for 4 weeks. Amiodarone activity was also monitored using electrocardiograms. The presence of bradycardia in amiodarone-treated rats confirmed that this drug was really active. Metaphase analysis on bone marrow cells showed that there were significant differences in total chromosomal damage and percentage abnormal metaphase between WKY and SHR negative controls. In the SHR negative control, the frequencies of basal chromosomal aberrations and abnormal metaphases were significantly higher (p < 0.05). There were high numbers of chromosomal aberrations in all amiodarone-treated groups, compared with negative controls. In amiodarone-treated groups, the most frequent chromosomal aberration was chromatid breaks. More chromosomal aberrations were found in WKYs that received amiodarone, with a statistically significant difference in comparison with negative controls (p < 0.05). However, in SHR rats there was no significant difference between the amiodarone and negative groups regarding chromosomal damage induction. These results showed that treatment with amiodarone was genotoxic in WKYs, but not in SHRs. Further studies are needed to confirm whether amiodarone is genotoxic or efficient and harmless, among humans undergoing therapy. (c) 2008 Published by Elsevier B.V.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cytogenetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

A novel genetic locus for low renin hypertension: familial hyperaldosteronism type II maps to chromosome 7 (7p22)

Familial hyperaldosteronism type II (FH-II) is caused by adrenocortical hyperplasia or aldosteronoma or both and is frequently transmitted in an autosomal dominant fashion. Unlike FH type I (FI-I-I), which results from fusion of the CYP11B1 and CYP11B2 genes, hyperaldosteronism in FH-II is not glucocorticoid remediable. A large family with FH-II was used for a genome wide search and its members were evaluated by measuring the aldosterone:renin ratio. In those with an increased ratio, FH-II was confirmed by fludrocortisone suppression testing. After excluding most of the genome, genetic linkage was identified with a maximum two point lod score of 3.26 at theta =0, between FH-II in this family and the polymorphic markers D7S511, D7S517, and GATA24F03 on chromosome 7,a region that corresponds to cytogenetic band 7p22. This is the first identified locus for FH-II; its molecular elucidation may provide further insight into the aetiology of primary aldosteronism.

EDD, the human orthologue of the hyperplastic discs tumour suppressor gene, is amplified and overexpressed in cancer

EDD (E3 isolated by differential display), located at chromosome 8q22.3, is the human orthologue of the Drosophila melanogaster tumour suppressor gene 'hyperplastic discs' and encodes a HECT domain E3 ubiquitin protein-ligase. To investigate the possible involvement of EDD in human cancer, several cancers from diverse tissue sites were analysed for allelic gain or loss (allelic imbalance, AI) at the EDD locus using an EDD-specific microsatellite, CEDD, and other polymorphic microsatellites mapped in the vicinity of the 8q22.3 locus. Of 143 cancers studied, 38 had AI at CEDD (42% of 90 informative cases). In 14 of these cases, discrete regions of imbalance encompassing 8q22.3 were present, while the remainder had more extensive 8q aberrations. AI of CEDD was most frequent in ovarian cancer (22/47 informative cases, 47%), particularly in the serous subtype (16/22, 73%), but was rare in benign and borderline ovarian tumours. AI was also common in breast cancer (31%), hepatocellular carcinoma (46%), squamous cell carcinoma of the tongue (50%) and metastatic melanoma (18%). AI is likely to represent amplification of the EDD gene locus rather than loss of heterozygosity, as quantitative RT-PCR and immunohistochemistry showed that EDD mRNA and protein are frequently overexpressed in breast and ovarian cancers, while among breast cancer cell lines EDD overexpression and increased gene copy number were correlated. These results demonstrate that AI at the EDD locus is common in a diversity of carcinomas and that the EDD gene is frequently overexpressed in breast and ovarian cancer, implying a potential role in cancer progression.

Intermittent target inhibition with dasatinib 100 mg once daily preserves efficacy and improves tolerability in imatinib-resistant and -intolerant chronic-phase chronic myeloid leukemia

Purpose Dasatinib is a BCR-ABL inhibitor, 325-fold more potent than imatinib against unmutated BCR-ABL in vitro. Phase II studies have demonstrated efficacy and safety with dasatinib 70 mg twice daily in chronic-phase (CP) chronic myelogenous leukemia (CML) after imatinib treatment failure. In phase I, responses occurred with once-daily administration despite only intermittent BCR-ABL inhibition. Once-daily treatment resulted in less toxicity, suggesting that toxicity results from continuous inhibition of unintended targets. Here, a dose-and schedule-optimization study is reported. Patients and Methods In this open-label phase III trial, 670 patients with imatinib-resistant or -intolerant CP-CML were randomly assigned 1: 1: 1: 1 between four dasatinib treatment groups: 100 mg once daily, 50 mg twice daily, 140 mg once daily, or 70 mg twice daily. Results With minimum follow-up of 6 months (median treatment duration, 8 months; range, = 1 to 15 months), marked and comparable hematologic (complete, 86% to 92%) and cytogenetic (major, 54% to 59%; complete, 41% to 45%) response rates were observed across the four groups. Time to and duration of cytogenetic response were similar, as was progression-free survival (8% to 11% of patients experienced disease progression or died). Compared with the approved 70-mg twice-daily regimen, dasatinib 100 mg once daily resulted in significantly lower rates of pleural effusion (all grades, 7% v 16%; P = .024) and grade 3 to 4 thrombocytopenia (22% v 37%; P = .004), and fewer patients required dose interruption (51% v 68%), reduction (30% v 55%), or discontinuation (16% v 23%). Conclusion Dasatinib 100 mg once daily retains the efficacy of 70 mg twice daily with less toxicity. Intermittent target inhibition with tyrosine kinase inhibitors may preserve efficacy and reduce adverse events.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Current Patient Management of Chronic Myeloid Leukemia in Latin America A Study by the Latin American Leukemia Net (LALNET)

BACKGROUND: Treatment recommendations have been developed for management of patients with chronic myeloid leukemia (CML). METHODS: A 30-item multiple-choice questionnaire was administered to 435 hematologists and oncohematologists in 16 Latin American countries. Physicians self-reported their diagnostic, therapeutic, and disease management strategies. RESULTS: Imatinib is available as initial therapy to 92% of physicians, and 42% of physicians have access to both second-generation tyrosine kinase inhibitors. Standard-dose imatinib is the preferred initial therapy for most patients, but 20% would manage a young patient initially with an allogeneic stem cell transplant from a sibling donor, and 10% would only offer hydroxyurea to an elderly patient. Seventy-two percent of responders perform routine cytogenetic analysis for monitoring patients on therapy, and 59% routinely use quantitative polymerase chain reaction. For patients who fail imatinib therapy, 61% would increase the dose of imatinib before considering change to a second-generation tyrosine kinase inhibitor, except for patients aged 60 years, for whom a switch to a second-generation tyrosine kinase inhibitor was the preferred choice. CONCLUSIONS: The answers to this survey provide insight into the management of patients with CML in Latin America. Some deviations from current recommendations were identified. Understanding the treatment patterns of patients with CML in broad population studies is important to identify needs and improve patient care. Cancer 2010;116:4991-5000. (C) 2070 American Cancer Society.

Reticular angiomatoid ""malignant"" fibrous histiocytoma-a case report with cytogenetics and molecular genetic analyses

Angiomatoid ""malignant"" fibrous histiocytoma is a rare sarcoma of low malignant potential that occurs most commonly in the extremities of children and young adults. Herein, we present a case of angiomatoid malignant fibrous histiocytoma with unusual histologic features arising in the mediastinum of an 80-year-old man. The tumor exhibited a reticular growth pattern and myxoid stroma. The tumor cells expressed epithelial membrane antigen and desmin. Cytogenetic analysis revealed the translocation t(2;22)(q33;q12). Molecular genetic analysis confirmed the rearrangement of the EWSR1 locus and the presence of the EWSR1/CREB1 fusion. This report expands the clinicopathologic spectrum of angiomatoid malignant fibrous histiocytoma and underscores the value of integrating morphologic, immunophenotypic, and molecular findings in the identification of its unusual morphologic variants. (C) 2011 Elsevier Inc. All rights reserved.