628 resultados para colonisation phénicienne
Resumo:
DUE TO COPYRIGHT RESTRICTIONS ONLY AVAILABLE FOR CONSULTATION AT ASTON UNIVERSITY LIBRARY AND INFORMATION SERVICES WITH PRIOR ARRANGEMENT
Resumo:
Some of the factors affecting colonisation of a colonisation sampler, the Standard Aufwuchs Unit (S. Auf. U.) were investigated, namely immersion period, whether anchored on the bottom or suspended, and the influence of riffles. It was concluded that a four-week immersion period was best. S. Auf. U. anchored on the bottom collected both more taxa and individuals than suspended ones. Fewer taxa but more individuals colonised S. Auf. U. in the potamon zone compared to the rhithron zone with a consequent reduction in the values of pollution indexes and diversity. It was concluded that a completely different scoring system was necessary for lowland rivers. Macroinvertebrates colonising S. Auf. U. in simulated streams, lowland rivers and the R. Churnet reflected water quality. A variety of pollution and diversity indexes were applied to results from lowland river sites. Instead of these, it was recommended that an abbreviated species - relative abundance list be used to summarise biological data for use in lowland river surveillance. An intensive study of gastropod populations was made in simulated streams. Lynnaea peregra increased in abundance whereas Potamopyrgas jenkinsi decreased with increasing sewage effluent concentration. No clear-cut differences in reproduction were observed. The presence/absence of eight gastropod taxa was compared with concentrations of various pollutants in lowland rivers. On the basis of all field work it appeared that ammonia, nitrite, copper and zinc were the toxicants most likely to be detrimental to gastropods and that P. jenkinsi and Theodoxus fluviatilis were the least tolerant taxa. 96h acute toxicity tests of P. jenkinsi using ammonia and copper were carried out in a flow-through system after a variety of static range finding tests. P. jenkinsi was intolerant to both toxicants compared to reports on other taxa and the results suggested that these toxicants would affect distribution of this species in the field.
Resumo:
DUE TO COPYRIGHT RESTRICTIONS ONLY AVAILABLE FOR CONSULTATION AT ASTON UNIVERSITY LIBRARY AND INFORMATION SERVICES WITH PRIOR ARRANGEMENT
Resumo:
Ce mémoire analyse le processus de romanisation et de colonisation de Xanten-Vetera, une région frontalière de l’Empire romain située en basse Rhénanie dans la province romaine de Germania inferior. À l’intérieur d’un cadre temporel inclus entre les conquêtes de Jules César et le milieu du second siècle apr. J.-C., l’étude cherche à comprendre et à restituer la présence militaire ainsi que le développement des peuplades civiles sur place, du fait des transferts de population et de l’immigration gallo-romaine. Le processus de romanisation est analysé en tenant compte des réalités ethnographiques, sociales et culturelles et selon les théories les plus actuelles de la recherche moderne sur ce sujet. Comme il s’agit d’une agglomération située sur une voie fluviale en périphérie de l’Empire, le concept de « frontière » y est évalué afin d’estimer si Xanten-Vetera constituait une zone de convergence ou de divergence par rapport à l’espace rhénan. Dans un deuxième temps, cette recherche analyse le contexte militaire et social durant lequel l’empereur Trajan prit la décision d’octroyer le statut de colonie à ce territoire qui devint la Colonia Ulpia Traiana. Cette démarche qui se veut régionale souligne la nature particulière de l’histoire de Xanten-Vetera sous le Haut Empire ; les migrations et les tragédies à l’intérieur de cet espace géographique ont façonné un endroit au destin unique en Germanie et dans l’Empire romain. Enfin, ce travail fournit un exemple pertinent de l’évolution des motivations qui ont guidé les politiques coloniales sous les Julio-Claudiens, les Flaviens et les Antonins et suggère l’essor des groupes de pression non militaires dans ce contexte.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
An unusual saltwater population of the "freshwater" crocodilian, Crocodylus johnstoni, was studied in the estuary of the Limmen Bight River in Australia's Northern Territory and compared with populations in permanently freshwater habitats. Crocodiles in the river were found across a large salinity gradient, from fresh water to a salinity of 24 mg.ml-1, more than twice the body fluid concentration. Plasma osmolarity, concentrations of plasma Na+, Cl-, and K+, and exchangeable Na+ pools were all remarkably constant across the salinity spectrum and were not substantially higher or more variable than those in crocodiles from permanently freshwater habitats. Body fluid volumes did not vary; condition factor and hydration status of crocodiles were not correlated with salinity and were not different from those of crocodiles from permanently fresh water. C. johnstoni clearly has considerable powers of osmoregulation in waters of low to medium salinity. Whether this osmoregulatory competence, extends to continuously hyperosmotic environments is not known, but distributional data suggest that C. johnstoni in hyperosmotic conditions may require periodic access to hypoosmotic water. The study demonstrates a physiological capacity for colonisation of at least some estuarine waters by this normally stenohaline freshwater crocodilian.
Resumo:
The effect of aging on host resistance to systemic candidosis was assessed by monitoring the course of infection in 16-month-old CBA/CaH mice (aged non-immune) and in a comparable group that had been infected with a sublethal dose of Candida albicans at 6 weeks of age (aged immune). Aged non-immune mice showed rapid progression of the disease, with a marked increase in the number of mycelia in the brain and kidney, and early morbidity, Foci of myocardial necrosis were evident, but inflammatory cells were sparse. The histological picture in the aged immune mice was similar to that in the aged non-immune group, although fewer mycelial aggregates were seen. Both groups of aged mice showed a significantly lower fungal burden in the brain on day 1 of infection, but on day 4, colony counts increased significantly in the aged non-immune mice, Comparison of cytokine gene expression in the infected brains showed that the relative amount of interferon-gamma and tumour necrosis factor-alpha cDNA were similar in all three groups. Interleukin-6 was elevated in both infected non-immune and uninfected aged mice. Aged immune mice showed no morbidity after challenge, and both colonisation and tissue damage were reduced in comparison with the aged non-immune animals.
Resumo:
The spatial pattern of outbreaks of pink wax scale, Ceroplastes rubens Maskell, within and among umbrella trees, Schefflera actinophylla (Endl.), in southeastern Queensland was investigated. Pink wax scale was common on S. actinophylla, with approximately 84% of trees positive for scale and 14% of bees recording outbreak densities exceeding 0.4 adults per leaflet. Highly aggregated distributions of C. rubens occur within and among umbrella trees. Clumped distributions within trees appear to result from variable birth and death rates and limited movement of first instar crawlers. The patchy distribution of pink wax scale among trees is probably a consequence of variation in dispersal success of scale, host and environmental suitability for establishment and rates of biological control. Pink wax scale was more prevalent on trees in roadside positions and in exposed situations, indicating that such trees are more suitable and/or susceptible to scale colonisation.
Resumo:
The efficient and correct folding of bacterial disulfide bonded proteins in vivo is dependent upon a class of periplasmic oxidoreductase proteins called DsbA, after the Escherichia coli enzyme. In the pathogenic bacterium Vibrio cholerae, the DsbA homolog (TcpG) is responsible for the folding, maturation and secretion of virulence factors. Mutants in which the tcpg gene has been inactivated are avirulent; they no longer produce functional colonisation pill and they no longer secrete cholera toxin. TcpG is thus a suitable target for inhibitors that could counteract the virulence of this organism, thereby preventing the symptoms of cholera. The crystal structure of oxidized TcpG (refined at a resolution of 2.1 Angstrom) serves as a starting point for the rational design of such inhibitors. As expected, TcpG has the same fold as E. coli DsbA, with which it shares similar to 40% sequence identity. Ln addition, the characteristic surface features of DsbA are present in TcpG, supporting the notion that these features play a functional role. While the overall architecture of TcpG and DsbA is similar and the surface features are retained in TcpG, there are significant differences. For example, the kinked active site helix results from a three-residue loop in DsbA, but is caused by a proline in TcpG (making TcpG more similar to thioredoxin in this respect). Furthermore, the proposed peptide binding groove of TcpG is substantially shortened compared with that of DsbA due to a six-residue deletion. Also, the hydrophobic pocket of TcpG is more shallow and the acidic patch is much less extensive than that of E. coli DsbA. The identification of the structural and surface features that are retained or are divergent in TcpG provides a useful assessment of their functional importance in these protein folding catalysts and is an important prerequisite for the design of TcpG inhibitors. (C) 1997 Academic Press Limited.
Resumo:
We investigated some of the factors that may lead to outbreaks of pink wax scale, Ceroplastes rubens Maskell, on umbrella trees, Schefflera actinophylla (Endl.). Estimates of birth and death rates of pink wax scale were high and variable within and among trees; variation in these rates was not related to scale density. Adult fecundity correlated significantly but weakly with adult test length; mean fecundity was 292 eggs per female with a range of 5-1178. Adult test length and its variance decreased weakly with increasing density. Field experiments showed that mortality of C. rubens is greatest during the first 24 hours after hatching when approximately half disappear. The rate of loss decreases over time with 0.3% of initial motile first-instar nymphs surviving to maturity. Rates of loss varied significantly between trees, indicating that some trees are more suitable for scale colonisation and survival.
Resumo:
Colonisation and infection by Candida species occur frequently in acquired immunodeficiency syndrome (AIDS), but their relationship to the humoral immunity against candidiasis is controversial. To evaluate the levels of antibodies to Candida in the serum and in the saliva of HIV-1-infected patients in relation to the presence of immunodeficiency, oral candidiasis and Candida colonisation, Candida was investigated in the urine and in the oral and anal mucosae of HIV-1-infected patients, AIDS patients and healthy controls. The levels of IgG, IgM and IgA antibodies to Candida were determined in the serum and in the saliva by immunoassay. Candida species were detected in 76% of the patients. Mucosal yeast colonisation and the levels of serum and saliva antibodies to Candida were similar between asymptomatic HIV-infected and non-infected patients. Mucosal colonisation was highest in AIDS patients, who also had higher serum IgA and saliva IgG antibodies. Antibody levels were similar in patients with and without candidiasis oral lesions. Asymptomatic HIV-infected individuals are similar to non-infected individuals with respect to mucosal colonisation as well as serum and saliva levels of antibodies to Candida. The higher mucosal colonisation and clinical candidiasis observed in the AIDS patients apparently stimulated a more intense humoral response to the yeast.
Resumo:
We use a stochastic patch occupancy model of invertebrates in the Mound Springs ecosystem of South Australia to assess the ability of incidence function models to detect environmental impacts on metapopulations. We assume that the probability of colonisation decreases with increasing isolation and the probability of extinction is constant across spring vents. We run the models to quasi-equilibrium, and then impose an impact by increasing the local extinction probability. We sample the output at various times pre- and postimpact, and examine the probability of detecting a significant change in population parameters. The incidence function model approach turns out to have little power to detect environmental impacts on metapopulations with small numbers of patches. (C) 2001 Elsevier Science Ltd. All rights reserved.