1000 resultados para Processo de nascimento e morte


Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper discusses the results obtained with homogeneous catalytic ozonation [Mn (II) and Cu (II)] in phenol degradation. The reduction of total phenols and total organic carbon (TOC) and the ozone consumption were evaluated. The efficiency in phenol degradation (total phenol removal) at pH 3, with the catalytic process (Mn (II)), increased from 37% to 55% while the TOC removal increased from 4 to 63% in a seven-minute treatment. The ozonation process efficiency at pH 10 was 43% and 39% for phenol and TOC removal, respectively. The presence of both metallic ions (Mn2+ and Cu+2) in the ozonation process resulted in a positive effect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Malaria is still one of the major diseases in the world, causing physical and economic problems in tropical regions. Artemisinin (Qinghaosu), a natural compound identified in Artemisia annua L. , is an effective drug mainly against cerebral malaria. The action of this drug is immediate and parasitaemia in the treatment of drug-resistant malaria is rapidily reduced, justifying the industrial production of artemisinin. This article focuses on the industrial production of this potent antimalarial drug, including strategies for enhancing yield using inexpensive and easy steps.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Edible mushroom are highly perishable foods. Drying is an alternative to provide safe storage. In this work, the effects of some drying parameters on the quality of Shiitake mushroom were investigated: geometry of the raw material (whole and sliced), drying temperature (50 °C and 70 ºC) and final moisture content (5% and 15% wb). Experimental kinetics of drying was built and color and texture analyses were done in fresh and in rehydrated dried product. The effect of parameters was evaluated by analysis of variance and test of multiple comparisons. Drying kinetics showed that drying happened in falling-rate period and sliced mushroom dried at 70 ºC required lesser drying time than other treatments. Mushroom dried at 70 ºC showed less darkening. Drying time affected mushroom quality, evaluated by great hardness, gummosis and darkening.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present work aimed to create a methodology to evaluate the pulverization process with the use of quality tools. It was listed the primary factors, secondary factors, tertiary factors and, with the check list tool support, the list was elaborated. It was evaluated the factors labor, agriculture machine, material and method of 32 pulverization process before pesticide application, in that each factor received a punctuation, having as total sum of 750 points. The medium punctuation to the factors labor, agriculture machine, material and method was 78; 211; 49; 20 and 94 points, respectively. The sum of the factors points for the 32 processes, the minimum value found was 230 and maximum was 620 points. With the proposed methodology, can be identify which common causes of the processes can affect its result.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Broccoli seeds were coated in a conical-cylindrical spouted bed with an aqueous suspension of hydroxy ethyl cellulose aiming to improve the seeds coating technique using a fluid-dynamic process. An experimental design was applied to investigate the effects of the operating variables: gas temperature, atomizing air pressure and suspension flow rate on the germination of the seeds and on the process efficiency. Results indicated that the operating variables affect both the coating process efficiency and the germination ability. However, the analysis didn t identify differences between the germination potential of coated and uncoated seeds. Coated seeds absorbed up to 10 percent less moisture than the uncoated ones, when the environment temperature and humidity were controlled over a period of time.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this article, it is discussed the role of interaction in the process of teaching and learning Portuguese of deaf students at an inclusive school. In the context where the research took place, the hearing teacher does not understand sign language, and there are, in her classroom, hearing students and four deaf students, being three of them sign language users. As the communication between the hearing teacher and the deaf students occurred in different codes - Portuguese and Brazilian sign language - and having a social-interactional approach of language (MOITA LOPES, 1986; FREIRE, 1999), we observed if the interaction among the subjects enabled the deaf students to understand what was being taught. The results showed that the fact of having four deaf students in the same classroom allowed them to work in a cooperative way. Besides, the sign language became more visible in this institution. On the other hand, the interaction between the teacher and her deaf students revealed to be of little significance to the learning process of this small group.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The unusual development of branches along the stem of Euterpe edulis is described for the first time. Branches originated at 2 to 190 cm from the ground. Ramified individuals and branches were able to produce reproductive structures and some branches produced roots. A plausible cause for the observed anomaly could be genetic problems due to small population sizes. The better agreement of this process can have a positive effect in the harvest of the heart of palm through the artificial induction of sprouts, what would prevent the death of the individual.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Fisica

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física