Richtige Anweisung, Reflectirende Telescopia, die es grossen Tubis weit zuvor thun, nach Gregorianischer und Newtonischer Art von mancherley Grösse und Einrichtung, samt zugehörigen Spiegeln und Gläsern desgleichen Perspective, Tubos und Microscopia zu verfertigen : Denen Schiffleuten, Geographis, Astronomis, Physicis, Künstlern und anderen, die dergleichen zur Luft und eigenem Gebrauche zubereiten wollen, sehr nützlich /

Mode of access: Internet.

Manual de bacteriologia e microscopia clinica ... com applicações á clinica medica e veterinaria.

Mode of access: Internet.

Modelagem dos efeitos da irradiação luminosa no cérebro de camundongos e rastreamento de neurônios durante experimentos de microscopia de fluorescência

The fluorescent proteins are an essential tool in many fields of biology, since they allow us to watch the development of structures and dynamic processes of cells in living tissue, with the aid of fluorescence microscopy. Optogenectics is another technique that is currently widely used in Neuroscience. In general, this technique allows to activate/deactivate neurons with the radiation of certain wavelengths on the cells that have ion channels sensitive to light, at the same time that can be used with fluorescent proteins. This dissertation has two main objectives. Initially, we study the interaction of light radiation and mice brain tissue to be applied in optogenetic experiments. In this step, we model absorption and scattering effects using mice brain tissue characteristics and Kubelka-Munk theory, for specific wavelengths, as a function of light penetration depth (distance) within the tissue. Furthermore, we model temperature variations using the finite element method to solve Pennes’ bioheat equation, with the aid of COMSOL Multiphysics Modeling Software 4.4, where we simulate protocols of light stimulation tipically used in optogenetics. Subsequently, we develop some computational algorithms to reduce the exposure of neuron cells to the light radiation necessary for the visualization of their emitted fluorescence. At this stage, we describe the image processing techniques developed to be used in fluorescence microscopy to reduce the exposure of the brain samples to continuous light, which is responsible for fluorochrome excitation. The developed techniques are able to track, in real time, a region of interest (ROI) and replace the fluorescence emitted by the cells by a virtual mask, as a result of the overlay of the tracked ROI and the fluorescence information previously stored, preserving cell location, independently of the time exposure to fluorescent light. In summary, this dissertation intends to investigate and describe the effects of light radiation in brain tissue, within the context of Optogenetics, in addition to providing a computational tool to be used in fluorescence microscopy experiments to reduce image bleaching and photodamage due to the intense exposure of fluorescent cells to light radiation.

Cemento endodontico iniettabile: ricerca del "carrier" mediante osservazioni di microscopia elettronica a scansione e misure di micro-permeabilita'

Questa tesi si pone l’obiettivo di individuare il corretto veicolo “carrier” per un cemento bioceramico premiscelato, iniettabile e pronto all’uso. Il suddetto cemento è creato per applicazioni di chiusura e otturazioni permanenti del canale radicolare. A tale scopo è stato analizzato anatomicamente il dente e sono state approfondite le patologie. In seguito si è posta particolare attenzione per l’endodonzia e la terapia endodontica ortograda. L’attenzione si è poi focalizzata sui cementi endodontici allo scopo di ricercare lo stato dell’arte circa le proprietà chimico-fisiche di cementi ampiamente utilizzati in odontoiatria quali il mineral trioxide aggregate (MTA) e il cemento da cui è derivato ossia il cemento Portland. La parte sperimentale dell’elaborato parte con l’idea di ricreare, presso il Centro di Ricerca Interdisciplinare di Biomineralogia, Cristallografia e Biomateriali del Dipartimento di Scienze della Terra e Geologico-Ambientali dell’Università di Bologna, un prodotto con le stesse caratteristiche di un cemento ad uso endodontico iniettabile attualmente in commercio. Si è quindi studiato non solo il comportamento ma si sono anche analizzate le caratteristiche superficiali al SEM del suddetto cemento additivato con differenti sostanze (acqua, PEG 400, etil-lattato, glicerina) in diverse quantità. Si è passati di poi a testare il campione dalle caratteristiche più vicine all’obiettivo su disco di dentina con il permeabilimetro di Pashley e successivamente, si sono osservati dischi di dentina dopo l’applicazione del cemento e dopo attacco acido al SEM.

Remoção de fósforo pela cianobactéria aphanothece microscopia nageli em cultivos heterotróficos

Nesta dissertação foi demostrada a potencialidade da cianobactéria Aphanothece microscopica Nägeli em cultivo heterotrófico para remover fósforo do efluente de laticínio, bem como o efeito da temperatura no bioprocesso. Para tanto o trabalho é composto por dois artigos. O primeiro intitula-se “Influência da temperatura na remoção de fósforo por Aphanothece microscopica Nägeli em biorreatores heterotróficos”, e teve por objetivo avaliar a eficiência da cianobactéria em remover heterotroficamente fósforo total dissolvido do efluente de processamento de laticínios. A análise dos resultados mostrou que a remoção de fósforo é independente de sua concentração no sistema, porém depende fortemente da temperatura. Ficou demostrado, que a remoção é altamente sensível a temperatura principalmente no intervalo de 10ºC – 20ºC e nessas condições a operacionalidade do biorreator deverá ser ajustada para manutenção da eficiência do processo. O segundo artigo tem como título “Dinâmica de remoção de fósforo por Aphanothece microscopica Nägeli em biorreatores heterotróficos” e avaliou a remoção das formas de fósforo reativo, fósforo hidrolisável, fósforo total e fósforo orgânico, total e dissolvida, bem como de DQO e NNTK nas temperaturas de 10ºC, 20ºC e 30ºC em 24 h, a fim de investigar a dinâmica de remoção de diferentes formas de fósforo do efluente de laticínio em biorreatores heterotróficos. Foi possível concluir que a fração de fósforo predominante no efluente de laticínio foi a orgânica dissolvida, seguida de fósforo reativo dissolvido. A cianobactéria foi capaz de remover formas simples de fósforo, como reativo e complexas, fósforo hidrolisável e orgânico, bem como DQO e N-NTK. No que se refere ao fósforo suspenso, foi verificado que as frações de fósforo orgânico suspenso e fósforo suspenso total apresentaram baixa remoção. Foi observado que no intervalo de 20ºC a 30ºC foi registrado o maior desempenho quanto à remoção de fósforo para um tempo de detenção hidráulica de 16 h. Nos experimentos realizados à temperatura de 20ºC foram registrados os melhores valores cinéticos resultando em uma máxima concentração celular de 0,84 g.L-1, velocidade máxima de crescimento de 8,64 dias-1 e produtividade de 3,85 g.L-1. dia-1. Assim, a análise dos resultados permite concluir que a remoção de fósforo, DQO e N-NTK em condições heterotróficas por Aphanothece microscopica Nägeli é rota em potencial para o tratamento de efluente de laticínio.

Observação da morfologia de solos por microscopia de forca atômica.

1992

Durabilidade de compósito biomassa vegetal-cimento modificado por polímero

The durability of the cellulose-cement composites is a decisive factor to introduce such material in the market. Polymers have been used in concrete and mortar production to increase its durability. The goal of this work was the physical and mechanical characterization of cellulose-cement composites modified by a polymer and the subsequent durability evaluation. The work also evaluated the dispersion of acrylic polymer in composites made of Pinus caribaea residues. The physical properties observed were water absorption by immersion and bulk density. Rupture modulus and toughness were determined by flexural test. The specimens were obtained from pads, produced by pressing and wet curing. Samples were subjected to accelerated aging tests by repeated wetting and drying cycles and hot-water bath and natural aging. The scanning electron microscopy (SEM) allowed verifying the fiber and composite characteristics along the time. For the composite range analyzed, it was observed the polymer improved the mechanical properties of composites besides a significant decreasing in water absorption. The use of polymer improved the performance of vegetable fiber-cement composites when compared to the conventional mortar, due to water absorption decreasing.

Taxonomic value of foliar characters in Dahlstedtia Malme: Leguminosae, Papilionoideae, Millettieae

Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.

Caracterização morfoanatômica e histoquímica de Cuphea carthagenensis (Jacq.) J.f. Macbr. (Lythraceae)

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Efeito de baixas doses de radiação X em feridas suturadas e não suturadas - estudo experimental em ratos

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Microencapsulação de óleo essencial de laranja

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Neuronal ceroid-lipofuscinosis, a type of amaurotic family idiocy: clinical and pathological study of four cases

Neuronal ceroid-lipofuscinosis (NCL) is a recent term, proposed for acurate designation of the late-onset types of Amaurotic Family Idiocy (AFI). Histopathology shows ubiquitous intraneuronal accumulation of lipopigments, being the most important factor for characterization of the entity at present time. Biochemical changes and pathogenesis are obscure. NCL is in contrast to the infantile type of AFI (Tay-Sachs disease), in which intraneuronal accumulation of gangliosides (sphingolipids) is due to the well known deficiency of a lysosomal enzyme. The authors report on four cases of NCL, two brothers of the late infantile (Jansky-Bielschowsky) type and a brother and a sister of the juvenile (Spielmeyer-Sjögren) type. One autopsy and three cortical biopsies revealed moderate to severe distention of the neurons by lipopigment, with nerve cell loss, gliosis and cerebral atrophy. Lipopigment was also increased in liver, heart and spleen. The patients were the first in Brazilian literature in whom the storage material was identified as lipopigment by histochemical methods. A brief summary of the clinical features of NCL is presented, and relevant problems are discussed, concerning interpretation of the nature of the storage material, and significance of the disease for gerontological research.

Effect of different cleansers on the surface of removable partial denture

Removable partial dentures (RPD) demand specific hygienic cleaning and the combination of brushing with immersion in chemical solutions has been the most recommended method for control of biofilm. However, the effect of the cleansers on metallic components has not been widely investigated. This study evaluated the effect of different cleansers on the surface of RPD. Five disc specimens (12 mm x 3 mm metallic disc centered in a 38 x 18 x 4 mm mould filled with resin) were obtained for each experimental situation: 6 solutions [Periogard (PE), Cepacol (CE), Corega Tabs (CT), Medical Interporous (MI), Polident (PO), 0.05% sodium hypochlorite (NaOCl), and distilled water (DW) control] and 2 Co-Cr alloys [DeguDent (DD) and VeraPDI (VPDI)] were used for each experimental situation. A 180-day immersion was simulated and the measurements of roughness (Ra, µm) of metal and resin were analyzed using 2-way ANOVA and Tukey’s test. The surface changes and tarnishes were examined with a scanning electronic microscopy (SEM). In addition, energy dispersive x-ray spectrometry (EDS) analysis was carried out at representative areas. Visually, NaOCl and MI specimens presented surface tarnishes. The roughness of materials was not affected by the solutions (p>0.05). SEM images showed that NaOCl and MI provided surface changes. EDS analysis revealed the presence of oxygen for specimens in contact with both MI and NaOCl solutions, which might suggest that the two solutions promoted the oxidation of the surfaces, thus leading to spot corrosion. Within the limitations of this study, it may be concluded that the NaOCl and MI may not be suitable for cleaning of RPD.