999 resultados para soil biology
Resumo:
Composts can provide a source of organic carbon and nutrients for soil biota and increase soil fertility as well as provide other biological and structural benefits hence compost addition to cotton soils is seen as a way to improve cotton soil biological health and fertility. In a six month incubation experiment we analysed the changes in microbial populations and activities related to C and N cycling following the application of feedlot, poultry manure and gin trash compost materials. A significant variation in the chemical composition, e.g. major nutrients and trace elements, was found between the three compost products. The feedlot compost generally contained higher levels of dissolved organic carbon, total nitrogen and bicarbonate extractable phosphorus whereas the Gin trash compost had lower carbon and nutrient concentrations. The effect of compost addition @ 5 and 10t/ha generally increased microbial activity but the effect was only evident during the first two weeks of incubation. Composts effects on the abundance of total bacteria (16S), nitrifying (amoA), nitrogen fixing (nifH) and denitrifying bacteria (nosZ) and total fungi (ITS gene) varied between different composts. The addition of feedlot and poultry compost material significantly increased the levels of dissolved organic carbon (DOC) and nitrogen (DON) in soil compared to that in control soils while ‘Gin trash’ compost had no effect. These differences reflected in the microbial catabolic diversity changes in the compost amended soils. Therefore, chemical analysis of the compost material before application is recommended to more fully consider its’ potential benefits.
Resumo:
Many rainfed wheat production systems are reliant on stored soil water for some or all of their water inputs. Selection and breeding for root traits could result in a yield benefit; however, breeding for root traits has traditionally been avoided due to the difficulty of phenotyping mature root systems, limited understanding of root system development and function, and the strong influence of environmental conditions on the phenotype of the mature root system. This paper outlines an international field selection program for beneficial root traits at maturity using soil coring in India and Australia. In the rainfed areas of India, wheat is sown at the end of the monsoon into hot soils with a quickly receding soil water profile; in season water inputs are minimal. We hypothesised that wheat selected and bred for high yield under these conditions would have deep, vigorous root systems, allowing them to access and utilise the stored soil water at depth around anthesis and grain-filling when surface layers were dry. The Indian trials resulted in 49 lines being sent to Australia for phenotyping. These lines were ranked against 41 high yielding Australian lines. Variation was observed for deep root traits e.g. in eastern Australia in 2012, maximum depth ranged from 118.8 to 146.3 cm. There was significant variation for root traits between sites and years, however, several Indian genotypes were identified that consistently ranked highly across sites and years for deep rooting traits.
Resumo:
The state of Florida has one of the most severe exotic species invasion problems in the United States, but little is known about their influence on soil biogeochemistry. My dissertation research includes a cross-continental field study in Australia, Florida, and greenhouse and growth chamber experiments, focused on the soil-plant interactions of one of the most problematic weeds introduced in south Florida, Lygodium microphyllum (Old World climbing fern). Analysis of field samples from the ferns introduced and their native range indicate that L microphyllum is highly dependent on arbuscular mycorrhizal fungi (AMF) for phosphorus uptake and biomass accumulation. Relationship with AMF is stronger in relatively dry conditions, which are commonly found in some Florida sites, compared to more common wet sites where the fern is found in its native Australia. In the field, L. microphyllum is found to thrive in a wide range of soil pH, texture, and nutrient conditions, with strongly acidic soils in Australia and slightly acidic soils in Florida. Soils with pH 5.5 - 6.5 provide the most optimal growth conditions for L. microphyllum, and the growth declines significantly at soil pH 8.0, indicating that further reduction could happen in more alkaline soils. Comparison of invaded and uninvaded soil characteristics demonstrates that L. microphyllum can change the belowground soil environment, with more conspicuous impact on nutrient-poor sandy soils, to its own benefit by enhancing the soil nutrient status. Additionally, the nitrogen concentration in the leaves, which has a significant influence in the relative growth rate and photosynthesis, was significantly higher in Florida plants compared to Australian plants. Given that L. microphyllum allocates up to 40% of the total biomass to rhizomes, which aid in rapid regeneration after burning, cutting or chemical spray, hence management techniques targeting the rhizomes look promising. Over all, my results reveal for the first time that soil pH, texture, and AMF are major factors facilitating the invasive success of L. mcirophyllum. Finally, herbicide treatments targeting rhizomes will most likely become the widely used technique to control invasiveness of L. microphyllum in the future. However, a complete understanding of the soil ecosystem is necessary before adding any chemicals to the soil to achieve a successful long-term invasive species management strategy.
Resumo:
Mine drainage is an important environmental disturbance that affects the chemical and biological components in natural resources. However, little is known about the effects of neutral mine drainage on the soil bacteria community. Here, a high-throughput 16S rDNA pyrosequencing approach was used to evaluate differences in composition, structure, and diversity of bacteria communities in samples from a neutral drainage channel, and soil next to the channel, at the Sossego copper mine in Brazil. Advanced statistical analyses were used to explore the relationships between the biological and chemical data. The results showed that the neutral mine drainage caused changes in the composition and structure of the microbial community, but not in its diversity. The Deinococcus/Thermus phylum, especially the Meiothermus genus, was in large part responsible for the differences between the communities, and was positively associated with the presence of copper and other heavy metals in the environmental samples. Other important parameters that influenced the bacterial diversity and composition were the elements potassium, sodium, nickel, and zinc, as well as pH. The findings contribute to the understanding of bacterial diversity in soils impacted by neutral mine drainage, and demonstrate that heavy metals play an important role in shaping the microbial population in mine environments.
Resumo:
Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences.
Resumo:
Silver nanoparticles have attracted considerable attention due to their beneficial properties. But toxicity issues associated with them are also rising. The reports in the past suggested health hazards of silver nanoparticles at the cellular, molecular, or whole organismal level in eukaryotes. Whereas, there is also need to examine the exposure effects of silver nanoparticle to the microbes, which are beneficial to humans as well as environment. The available literature suggests the harmful effects of physically and chemically synthesised silver nanoparticles. The toxicity of biogenically synthesized nanoparticles has been less studied than physically and chemically synthesised nanoparticles. Hence, there is a greater need to study the toxic effects of biologically synthesised silver nanoparticles in general and mycosynthesized nanoparticles in particular. In the present study, attempts have been made to assess the risk associated with the exposure of mycosynthesized silver nanoparticles on a beneficial soil microbe Pseudomonas putida. KT2440. The study demonstrates mycosynthesis of silver nanoparticles and their characterisation by UV-vis spectrophotometry, FTIR, X-ray diffraction, nanosight LM20 - a particle size distribution analyzer and TEM. Silver nanoparticles obtained herein were found to exert the hazardous effect at the concentration of 0.4μg/ml, which warrants further detailed investigations concerning toxicity.
Resumo:
Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.
Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.
Resumo:
In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.
Resumo:
This survey aimed at describing the interactions of floral visitors and Davilla kunthii A. St.-Hil. as well as characteristics of its reproductive biology in Itacoatiara, state of Amazonas, Brazil. Tests of the breeding system were performed. The guild of visitors was described according to richness, abundance, relative frequency and constancy. The breeding system tests indicated that D. kunthii is self-compatible. The pollination system was characterized as generalist, with 39 visitor species, from three different orders. Bees were the main group of pollinators, thus some behavioural aspects were described. Th e period of highest foraging activity was between 7 and 10 am. Some species presented agonistic and monopolistic behaviour. Given the behaviour and destructive potential, the Curculionidae seem to have a greater impact as seed predators than pollinators.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.
Resumo:
Gaseous N losses from soil are considerable, resulting mostly from ammonia volatilization linked to agricultural activities such as pasture fertilization. The use of simple and accessible measurement methods of such losses is fundamental in the evaluation of the N cycle in agricultural systems. The purpose of this study was to evaluate quantification methods of NH3 volatilization from fertilized surface soil with urea, with minimal influence on the volatilization processes. The greenhouse experiment was arranged in a completely randomized design with 13 treatments and five replications, with the following treatments: (1) Polyurethane foam (density 20 kg m-3) with phosphoric acid solution absorber (foam absorber), installed 1, 5, 10 and 20 cm above the soil surface; (2) Paper filter with sulfuric acid solution absorber (paper absorber, 1, 5, 10 and 20 cm above the soil surface); (3) Sulfuric acid solution absorber (1, 5 and 10 cm above the soil surface); (4) Semi-open static collector; (5) 15N balance (control). The foam absorber placed 1 cm above the soil surface estimated the real daily rate of loss and accumulated loss of NH3N and proved efficient in capturing NH3 volatized from urea-treated soil. The estimates based on acid absorbers 1, 5 and 10 cm above the soil surface and paper absorbers 1 and 5 cm above the soil surface were only realistic for accumulated N-NH3 losses. Foam absorbers can be indicated to quantify accumulated and daily rates of NH3 volatilization losses similarly to an open static chamber, making calibration equations or correction factors unnecessary.
Resumo:
Ferruginous "campos rupestres" are a particular type of vegetation growing on iron-rich primary soils. We investigated the influence of soil properties on plant species abundance at two sites of ferruginous "campos rupestres" and one site of quartzitic "campo rupestre", all of them in "Quadrilátero Ferrífero", in Minas Gerais State, southeastern Brazil. In each site, 30 quadrats were sampled to assess plant species composition and abundance, and soil samples were taken to perform chemical and physical analyses. The analyzed soils are strongly acidic and presented low fertility and high levels of metallic cations; a principal component analysis of soil data showed a clear segregation among sites due mainly to fertility and heavy metals content, especially Cu, Zn, and Pb. The canonical correspondence analysis indicated a strong correlation between plant species abundance and soil properties, also segregating the sites.
Resumo:
Though introduced recently, complex networks research has grown steadily because of its potential to represent, characterize and model a wide range of intricate natural systems and phenomena. Because of the intrinsic complexity and systemic organization of life, complex networks provide a specially promising framework for systems biology investigation. The current article is an up-to-date review of the major developments related to the application of complex networks in biology, with special attention focused on the more recent literature. The main concepts and models of complex networks are presented and illustrated in an accessible fashion. Three main types of networks are covered: transcriptional regulatory networks, protein-protein interaction networks and metabolic networks. The key role of complex networks for systems biology is extensively illustrated by several of the papers reviewed.