Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Surface modification of bovine bone ash prepared by milling and acid washing process

Bovine bone ash is the main raw material for fabrication of bone china, a special kind of porcelain that has visual and mechanical advantages when compared to usual porcelains. The properties of bone china are highly dependent on the characteristics of the bone ash. However, despite a relatively common product, the science behind formulations and accepted fabrication procedures for bone china is not completely understood and deserves attention for future processing optimizations. In this paper, the influence of the preparation steps (firing, milling, and washing of the bones) on the physicochemical properties of bone ash particles was investigated. Bone powders heat-treated at temperatures varying from 700 to 1000 degrees C were washed and milled. The obtained materials were analyzed in terms of particle size distribution, chemical composition, density, specific surface area, FTIR spectroscopy, dynamic electrophoretic mobility, crystalline phases and scanning electron microscopy. The results indicated that bone ash does not significantly change in terms of chemistry and physical features at calcination temperatures above 700 degrees C. After washing in special conditions, one could only observe hydroxyapatite in the diffraction pattern. By FTIR it was observed that carbonate seems to be mainly concentrated on the surface of the powders. Since this compound can influence in the dispersion stability, and consequently in the quality of the final bone china product, and considering optimal washing parameters based on the dynamic electrophoretic mobility results, we describe a procedure for surface cleaning. (c) 2009 Elsevier Ltd and Techna Group S.r.l. All rights reserved.

Biogenesis of sex pheromones in the female olive fruit-fly

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.

Efficacy of zeta-cypermethrin as pour-on or spray formulations for the control of buffalo fly (Haematobia irritans exigua) in cattle

Objective To determine the efficacy of zeta-cypermethrin in controlling buffalo fly (Haematobia irritans exigua). Design Five field trials in northern and central Queensland. Procedure Zeta-cypermethrin pour-on at 2.5 mg/kg, spray at 62.5 ppm, deltamethrin pour-on and pour-on vehicle were applied to groups of 20 cattle. Buffalo fly counts were conducted three times before treatment and 3, 7, 14, 21, 28 and 35 days after treatment. Results In central Queensland where synthetic pyrethroid resistance in buffalo fly populations was rare, 2.5 mg/kg of zeta-cypermethrin pour-on gave good control of buffalo fly for 4 weeks and was better than a deltamethrin product. A zeta-cypermethrin spray used at 62.5 ppm gave 14 days control. In far-north Queensland where resistance to synthetic pyrethroids and heavy rain was common, the maximum period of efficacy of zeta-cypermethrin pour-on was reduced to 2 weeks. Conclusion In areas where there is low resistance to synthetic pyrethroids among buffalo flies, zeta-cypermethrin pour-on can be expected to give good control for 4 weeks.

Sex pheromone biosynthesis in the female olive fruit-fly. Double labelling from [O-18(2)]-dioxygen into 1,7-dioxaspiro[5.5]undecane

The demonstration that both oxygen atoms of 1,7-dioxaspiro[5.5] undecane (1), the sex-pheromone of the female olive fly, originate from dioxygen, strongly implicates monooxygenase mediated processes in assembly of (1), and reveals unexpected complexity in the formation of its nine-carbon precursor.

Reproductive biology and pollination of Govenia utriculata: A syrphid fly orchid pollinated through a pollen-deceptive mechanism

The reproductive biology and pollination mechanisms of Govenia utriculata (Sw.) Lindl. were studied in a mesophytic semideciduous forest at Serra do Japi, south-eastern Brazil. The floral visitors and pollination mechanisms were recorded, and experimental pollinations were carried out to determine the breeding system of this species. Populations of G. utriculata growing at Serra do Japi are exclusively visited and pollinated by two species of hoverflies in the genus Salpingogaster (Diptera: Syrphidae) that are attracted by deceit to the flowers of this orchid species. The lip apex and the column base present small brownish and yellow to orange spots that mimic pollen clusters. Govenia utriculata is self-compatible, but pollinator dependent. Natural fruit set was low (10%), but similar to that of other non-obligatorily autogamous sympatric orchid species that occur at Serra do Japi and of other fly-pollinated orchid species pollinated through deceptive mechanisms.

An Insight into the Sialotranscriptome of Simulium nigrimanum, a Black Fly Associated with Fogo Selvagem in South America

Pemphigus foliaceus is a life threatening skin disease that is associated with autoimmunity to desmoglein, a skin protein involved in the adhesion of keratinocytes. This disease is endemic in certain areas of South America, suggesting the mediation of environmental factors triggering autoimmunity. Among the possible environmental factors, exposure to bites of black flies, in particular Simulittm nigrimanum has been suggested. In this work, we describe the sialotranscriptome of adult female S. nigrimanum flies. It reveals the complexity of the salivary potion of this insect, comprised by over 70 distinct genes within over 30 protein families, including several novel families, even when compared with the previously described sialotranscriptome of the autogenous black fly, S. vitiation. The uncovering of this sialotranscriptome provides a platform for testing pemphigus patient sera against recombinant salivary proteins from S. nigrimanum and for the discovery of novel pharmacologically active compounds.

Predicting coal ash slag flow characteristics (viscosity model for the Al2O3-CaO-'FeO'-SiO2 system)

A model has been developed which enables the viscosities of coal ash slags to be predicted as a function of composition and temperature under reducing conditions. The model describes both completely liquid and heterogeneous, i.e. partly crystallised, slags in the Al2O3-CaO-'FeO'-SiO2 system in equilibrium with metallic iron. The Urbain formalism has been modified to describe the viscosities of the liquid slag phase over the complete range of compositions and a wide range of temperatures. The computer package F * A * C * T was used to predict the proportions of solids and the compositions of the remaining liquid phases. The Roscoe equation has been used to describe the effect of presence of solid suspension (slurry effect) on the viscosity of partly crystallised slag systems. The model provides a good description of the experimental data of fully liquid, and liquid + solids mixtures, over the complete range of compositions and a wide range of temperatures. This model can now be used for viscosity predictions in industrial slag systems. Examples of the application of the new model to coal ash fluxing and blending are given in the paper. (C) 2001 Elsevier Science Ltd. All rights reserved.

Host preference and host suitability in an egg-pupal fruit fly parasitoid, Fopius arisanus (Sonan) (Hym., Braconidae)

The relative oviposition rate of the parasitoid Fopius arisanus (Sonan) was investigated across three frugivorous tephritid species, Bactrocera tryoni Froggart, Bactrocera jarvisi (Tryon) and Bactrocera cucumis French. Choice and no-choice tests were both used. The suitability of these three species for sustaining larval development and survival to the adult stage was also assessed. Fopius arisanus parasitized all three tephritid species. regardless of the method of exposure, but showed stronger preference for B. tryoni and B. jarvisi over B. cucumis. Superparasitism was extremely rare. Successful development of F. arisanus varied across host species. Bactrocera tryoni yielded significantly more parasitoids than B. jarvisi, but no wasps emerged from B. cucumis puparia. Tests were set up in replicated trials. but results were not homogeneous across trials. We discuss the host relationships of F. arisanus with reference to this variation and in relation to host suitability for larval development.

Olfaction in the Queensland fruit fly, Bactrocera tryoni. I: Identification of olfactory receptor neuron types responding to environmental odors

The electroantennogram method was used to investigate the number of distinct olfactory receptor neuron types responding to a range of behaviorally active volatile chemicals in gravid Queensland fruit flies, Bactrocera tryoni. Three receptor neuron types were identified. One type responds to methyl butyrate, 2-butanone, farnesene, and carbon dioxide; a second to ethanol; and a third to n-butyric acid and ammonia. The receptor neuron type responding to methyl butyrate, 2-butanone, farnesene, and carbon dioxide consists of three subtypes. The presence of a limited number of receptor neuron types responding to a diverse set of chemicals and the reception of carbon dioxide by a receptor neuron type that responds to other odorants are novel aspects of the peripheral olfactory discrimination process.

Olfaction in the Queensland fruit fly, Bactrocera tryoni. II: Response spectra and temporal encoding characteristics of the carbon dioxide receptors

Single-unit electrophysiology was used to record the nerve impulses from the carbon dioxide receptors of female Queensland fruit flies, Bactrocera tryoni. The receptors responded to stimulation in a phasic-tonic manner and also had a period of inhibition of the nerve impulses after the end of stimulation, at high stimulus intensities. The cell responding to carbon dioxide was presented with a range of environmental odorants and found to respond to methyl butyrate and 2-butanone. The coding characteristics of the carbon dioxide cell and the ability to detect other odorants are discussed, with particular reference to the known behavior of the fly.