982 resultados para TRAD-MCN BIOASSAY


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

In vitro culture of the mutualistic fungus of leaf-cutting ants is troublesome due to its low growth rate, which leads to storage problems and contaminants accumulation. This paper aims at comparing the radial growth rate of the mutualistic fungus of Atta sexdens rubropilosa Forel in two different culture media (Pagnocca B and MEA LP). Although total MEA LP radial growth was greater all along the bioassay, no significant difference was detected between growth efficiencies of the two media. Previous evidences of low growth rate for this fungus were confirmed. Since these data cannot point greater efficiency of one culture medium over the other, MEA LP medium is indicated for in vitro studies with this mutualistic fungus due its simpler composition and translucent color, making the analysis easier.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

PURPOSE: To evaluate the corneal vascularization (CV) and the clinical aspects induced by interlamellar graft with native (NCM) and anionic (ACM) collagen membranes in rabbits corneas. METHODS: An interlamellar graft with a 0.25 x 0.25 cm NCM (group 1) or ACM (group 2) fragment was performed in the right eye (treated eye). In the left eye, an estromal tunnel was done (control eye). Sixteen rabbits were used, and they were subdivided into two experimental groups of eight animals each. The clinical evaluation was performed at the 1st, 3rd, 7th, 15th and 30th postoperative days. Corneal vascularization analysis was performed after 30 days by the Images Analizator System Leica Qwin-550®. RESULTS: After 7 days, corneal vascularization was observed at about 2.25 ± 0.71 mm (NCM) and at about 1.0 ± 1.69 mm (ACM), respectively, from the limbus in direction to the central cornea. After 15 days, CV increased in both groups (5.25 ± 1.03 mm - NCM; 2.0 ± 2.39 mm - ACM) and then progressively decreased until day 30 (2.25 ± 2.10 mm - NCM; 0.75 ± 2.12 mm - ACM). The statistical analysis indicated that the averages of the distances from the limb vessels to the grafts observed after 7 and 15 days had not differed statistically (p=0.17), and after 15 and 30 postoperative days had a tendency to differ statistically (p=0.09). The control eyes did not present any changes. CONCLUSION: The interlamellar graft with native and anionic collagen membranes induced corneal vascularization when applied to rabbit corneas, but anionic collagen membrane induced a smaller corneal vascularization when compared to native collagen membrane. Although further studies are required, the results found in this study demonstrated the usefulness of interlamellar graft with native and anionic collagen membranes in keratoplasties. These membranes consists in one more graft option for the surgical treatment of corneal repair in rabbits and others animals, when other forms of medical and surgical treatment are not effective.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The in vitro activity of the crude hydroalcoholic extract of the aerial parts of Miconia langsdorffii Cogn. was evaluated against the promastigote forms of L. amazonensis, the causative agent of cutaneous leishmaniasis in humans. The bioassay-guided fractionation of this extract led to identification of the triterpenes ursolic acid and oleanolic acid as the major compounds in the fraction that displayed the highest activity. Several ursolic acid semi-synthetic derivatives were prepared, to find out whether more active compounds could be obtained. Among these ursolic acid-derived substances, the C-28 methyl ester derivative exhibited the best antileishmanial activity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Segments of the canine internal mammary artery (35 mm in length) were suspended in vitro in an organ chamber containing physiological salt solution (95% O(2)/5% CO(2), pH = 7.4, 37 degrees C). Segments were individually cannulated and perfused at 5 ml/minute using a roller pump. Vasorelaxant activity of the effluent from the perfused internal mammary arteries was bioassayed by measuring the decrease in tension induced by the effluent of the coronary artery endothelium-free ring which had been contracted with prostaglandin F(2 alpha) (2 x 10(-6) M). Intraluminal perfusion of adenosine diphosphate (10(-5) M) induced significant increase in relaxant activity in the effluent from the perfused blood vessel. However, when adenosine diphosphate (10(-5) M) was added extraluminally to the internal mammary artery, no change in relaxant activity in the effluent was noted. In contrast, acetylcholine produced significant increase in the relaxant activity on the effluent of the perfused internal mammary artery with both intraluminal and extraluminal perfusion. The intraluminal and extraluminal release of endothelium-derived relaxing factor (EDRF) by acetylcholine (10(-5) M) can be inhibited by site-specific administration of atropine (10(-5) M). These experiments indicate that certain agonists can induce the release of EDRF only by binding to intravascular receptors while other agonists can induce endothelium-dependent vasodilatation by acting on neural side receptors.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Mercury (Hg) pollution is one of the most serious environmental problems. Due to public concern prompted by the symptoms displayed by people who consumed contaminated fish in Minamata, Japan in 1956, Hg pollution has since been kept under constant surveillance. However, despite considerable accumulation of knowledge on the noxious effects of ingested or inhaled Hg, especially for humans, there is virtually nothing known about the genotoxic effects of Hg. Because increased mitotic crossing over is assumed to be the first step leading to carcinogenesis, we used a sensitive short-term test (homozygotization index) to look for DNA alterations induced by Hg fumes. In one Aspergillus nidulans diploid strain (UT448//UT184), the effects of the Hg fumes appeared scattered all over the DNA, causing 3.05 times more recombination frequencies than the mean for other strains. Another diploid (Dp II- I//UT184) was little affected by Hg. This led us to hypothesize that a genetic factor present in the UT184 master strain genome, close to the nicB8 genetic marker, is responsible for this behavior. These findings corroborate our previous findings that the homozygotization index can be used as a bioassay for rapid and efficient assessment of ecotoxicological hazards.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study outlines the quantification of low levels of Alicyclobacillus acidoterrestris in pure cultures, since this bacterium is not inactivated by pasteurization and may remain in industrialized foods and beverages. Electroconductive polymer-modified fluorine tin oxide (FTO) electrodes and multiple nanoparticle labels were used for biosensing. The detection of A. acidoterrestris in pure cultures was performed by reverse transcription polymerase chain reaction (RT-PCR) and the sensitivity was further increased by asymmetric nested RT-PCR using electrochemical detection for quantification of the amplicon. The quantification of nested RT-PCR products by Ag/Au-based electrochemical detection was able to detect 2 colony forming units per mL (CFU mL(-1)) of spores in pure culture and low detection and quantification limits (7.07 and 23.6 nM, respectively) were obtained for the target A. acidoterrestris on the electrochemical detection bioassay.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

While evaluating several laboratory-cultured cyanobacteria strains for the presence of paralytic shellfish poison neurotoxins, the hydrophilic extract of Microcystis aeruginosa strain SPC777-isolated from Billings`s reservoir, So Paulo, Brazil-was found to exhibit lethal neurotoxic effect in mouse bioassay. The in vivo test showed symptoms that unambiguously were those produced by PSP. In order to identify the presence of neurotoxins, cells were lyophilized, and the extracts were analyzed by HPLC-FLD and HPLC-MS. HPLC-FLD analysis revealed four main Gonyautoxins: GTX4(47.6%), GTX2(29.5%), GTX1(21.9%), and GTX3(1.0%). HPLC-MS analysis, on other hand, confirmed both epimers, with positive Zwitterions M(+) 395.9 m/z for GTX3/GTX2 and M(+) 411 m/z for GTX4/GTX1 epimers. The hepatotoxins (Microcystins) were also evaluated by ELISA and HPLC-MS analyses. Positive immunoreaction was observed by ELISA assay. Alongside, the HPLC-MS analyses revealed the presence of [l-ser(7)] MCYST-RR. The N-methyltransferase (NMT) domain of the microcystin synthetase gene mcyA was chosen as the target sequence to detect the presence of the mcy gene cluster. PCR amplification of the NMT domain, using the genomic DNA of the SPC777 strain and the MSF/MSR primer set, resulted in the expected 1,369 bp product. The phylogenetic analyses grouped the NMT sequence with the NMT sequences of other known Microcystis with high bootstrap support. The taxonomical position of M. aeruginosa SPC777 was confirmed by a detailed morphological description and a phylogenetic analysis of 16S rRNA gene sequence. Therefore, co-production of PSP neurotoxins and microcystins by an isolated M. aeruginosa strain is hereby reported for the first time.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Diagnosing herbicide-resistant weed populations is the first step for herbicide resistance management. Monitoring the nature, distribution, and abundance of the resistant plants in fields demands efficient and effective screening tests. Different glyphosate resistant populations of Lolium multiflorum (VA) and L. rigidum (C) were used in assays for testing their effectiveness to detect herbicide resistance. According to a Petri dish bioassay 7 days after treatment (DAT), the VA and the C populations were 27 and 31 times more resistant to glyphosate than the susceptible populations, L. multiflorum (SM) and L. rigidum (SR), respectively. On a whole-plant bioassay (21 DAT), the VA and the C populations were 6 and 11 times more resistant to glyphosate than their respective susceptible populations. The susceptible populations accumulated 2.5 and 1.4-fold more shikimic acid 48 hours after treatment (HAT), than the resistant VA and C. Glyphosate gradually inhibited net photosynthesis in all populations but at 48-72 HAT the resistant plants recovered, whereas no recovery was detected in susceptible populations. All assays were capable of detecting the resistant populations and this may be useful for farmers and consultants as an effective tool to reduce the spread of the resistant populations through quicker implementation of alternative weed management practices. However, they differed in time, costs and equipments necessaries for successfully carrying on the tests. Regarding costs, the cheapest ones were Petri dish and whole-plant bioassays, but they are time-consuming methods as the major constraints are the collection of seeds from the field and at least some weeks to evaluate the resistance. The shikimic acid and net photosynthesis assays were the quickest ones but they demand sophisticated equipments which could restrict its use.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study consists of the bioassay-guided fractionation of the dichloromethane extract from Eudistoma vannamei and the pharmacological characterization of the active fractions. The dried hydromethanolic extract dissolved in aqueous methanol was partitioned with dichloromethane and chromatographed on a silica gel flash column. The anti-proliferative effect was monitored by the MTT assay. Four of the latest fractions, numbered 14 to 17, which held many chemical similarities amongst each other, were found to be the most active. The selected fractions were tested for viability, proliferation and death induction on cultures of HL-60 promycloblastic leukemia cells. The results suggested that the observed cytotoxicity is related to apoptosis induction. (C) 2007 Elsevier Inc. All rights reserved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Investigation of the bioactive crude extracts from two populations of the red alga Laurencia dendroidea from the southeastern Brazilian coast led to the identification of five sesquiterpenes: (+)-obtusane (1), a triquinane derivative (2), (-)-elatol (3), obtusol (4), and cartilagineol (5). An antileishmanial bioassay against Leishmania amazonensis was conducted for crude lipophilic extracts and for sesquiterpenes 2, 3, and 4. Compounds 3 and 4 displayed in vitro and in vivo leishmanicidal activity and very low cytotoxicity.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Crude extracts of a callus culture (two culture media) and adult plants (two collections) from Alternanthera tenella Colla (Amaranthaceae) were evaluated for their antibacterial and antifungal activity, in order to investigate the maintenance of antimicrobial activity of the extracts obtained from plants in vivo and in vitro. The antibacterial and antifungal activity was determined against thirty strains of microorganisms including Gram-positive and Gram-negative bacteria, yeasts and dermatophytes. Ethanolic and hexanic extracts of adult plants collected during the same period of the years 1997 and 2002 [Ribeirao Preto (SP), collections 1 and 2] and obtained from plant cell callus culture in two different hormonal media (AtT43 and AtT11) inhibited the growth of bacteria, yeasts and dermatophytes with inhibition halos between 6 and 20 mm. For the crude extracts of adult plants bioassay-guided fractionation, purification, and isolation were performed by chromatographic methods, and the structures of the isolated compounds were established by analysis of chemical and spectral evidences (UV, IR, NMR and ES-MS). Steroids, saponins and flavonoids (aglycones and C-glycosides) were isolated. The minimum inhibitory concentration (MIC) of the isolated compounds varied from 50 to 500 mu g/mL.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

T cells recognize peptide epitopes bound to major histocompatibility complex molecules. Human T-cell epitopes have diagnostic and therapeutic applications in autoimmune diseases. However, their accurate definition within an autoantigen by T-cell bioassay, usually proliferation, involves many costly peptides and a large amount of blood, We have therefore developed a strategy to predict T-cell epitopes and applied it to tyrosine phosphatase IA-2, an autoantigen in IDDM, and HLA-DR4(*0401). First, the binding of synthetic overlapping peptides encompassing IA-2 was measured directly to purified DR4. Secondly, a large amount of HLA-DR4 binding data were analysed by alignment using a genetic algorithm and were used to train an artificial neural network to predict the affinity of binding. This bioinformatic prediction method was then validated experimentally and used to predict DR4 binding peptides in IA-2. The binding set encompassed 85% of experimentally determined T-cell epitopes. Both the experimental and bioinformatic methods had high negative predictive values, 92% and 95%, indicating that this strategy of combining experimental results with computer modelling should lead to a significant reduction in the amount of blood and the number of peptides required to define T-cell epitopes in humans.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Bioassay-directed fractionation of the ethanol extracts of two Amphimedon spp. collected during trawling operations in the Great Australian Eight yielded four new macrocyclic lactone/lactams, amphilactams A-D (1-4). The amphilactams possess potent in vitro nematocidal properties, and their structures were assigned on the basis of detailed spectroscopic analysis and comparison with synthetic model compounds. The amphilactams feature both carbon skeletons and an enamino lactone/lactam moiety unprecedented in the natural products literature.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The crude EtOH extract of an Echinodictyum sp. collected during trawling operations in the Great Australian Eight, Australia, displayed antibacterial and antiparasitic properties. Bioassay-directed fractionation yielded three novel sulfonic acids, the echinosulfonic acids A to C (1-3), and a new sulfone, echinosulfone A (4). Structures were assigned to these compounds on the basis of detailed spectroscopic analysis. It was determined that echinosulfonic acids A-C (1-3) and echinosulfone A(4) contributed to the antibacterial but not antiparasitic activity of the crude extract.