980 resultados para Capillary electrophoresis
Resumo:
This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
Combining data from multiple analytical platforms is essential for comprehensive study of the molecular phenotype (metabotype) of a given biological sample. The metabolite profiles generated are intrinsically dependent on the analytical platforms, each requiring optimization of instrumental parameters, separation conditions, and sample extraction to deliver maximal biological information. An in-depth evaluation of extraction protocols for characterizing the metabolome of the hepatobiliary fluke Fasciola hepatica, using ultra performance liquid chromatography and capillary electrophoresis coupled with mass spectroscopy is presented. The spectrometric methods were characterized by performance, and metrics of merit were established, including precision, mass accuracy, selectivity, sensitivity, and platform stability. Although a core group of molecules was common to all methods, each platform contributed a unique set, whereby 142 metabolites out of 14,724 features were identified. A mixture design revealed that the chloroform:methanol:water proportion of 15:59:26 was globally the best composition for metabolite extraction across UPLC-MS and CE-MS platforms accommodating different columns and ionization modes. Despite the general assumption of the necessity of platform-adapted protocols for achieving effective metabotype characterization, we show that an appropriately designed single extraction procedure is able to fit the requirements of all technologies. This may constitute a paradigm shift in developing efficient protocols for high-throughput metabolite profiling with more-general analytical applicability.
Resumo:
A method using Liquid Phase Microextraction for simultaneous detection of citalopram (CIT), paroxetine (PAR) and fluoxetine (FLU), using venlafaxine as internal standard, in plasma by high performance liquid chromatography with fluorescence detection was developed. The linearity was evaluated between 5.0 and 500 ng mL(-1) (r > 0.99) and the limit of quantification was 2.0, 3.0 and 5.0 ng mL-1 for CIT. PAR and FLU, respectively. Therefore, it can be applied to therapeutic drug monitoring, pharmacokinetics or bioavailability studies and its advantages are that it necessary relatively inexpensive equipment and sample preparation techniques.
Resumo:
Amperometry coupled to flow injection analysis (FIA) and to batch injection analysis (BIA) was used for the rapid and precise quantification of ciclopirox olamine in pharmaceutical products. The favourable hydrodynamic conditions provided by both techniques allowed a very high throughput (more than 300 injections per hour) with good linear range (2.0200 mu mol L-1) and low limits of detection (below 1.0 mu mol?L-1). The results obtained were compared with titration recommended by the American Pharmacopoeia and also using capillary electrophoresis. Good agreement between all results were achieved, demonstrating the good performance of amperometry combined with FIA and BIA.
Resumo:
This paper describes a long-range remotely controlled CE system built on an all-terrain vehicle. A four-stroke engine and a set of 12-V batteries were used to provide power to a series of subsystems that include drivers, communication, computers, and a capillary electrophoresis module. This dedicated instrument allows air sampling using a polypropylene porous tube, coupled to a flow system that transports the sample to the inlet of a fused-silica capillary. A hybrid approach was used for the construction of the analytical subsystem combining a conventional fused-silica capillary (used for separation) and a laser machined microfluidic block, made of PMMA. A solid-state cooling approach was also integrated in the CE module to enable controlling the temperature and therefore increasing the useful range of the robot. Although ultimately intended for detection of chemical warfare agents, the proposed system was used to analyze a series of volatile organic acids. As such, the system allowed the separation and detection of formic, acetic, and propionic acids with signal-to-noise ratios of 414, 150, and 115, respectively, after sampling by only 30 s and performing an electrokinetic injection during 2.0 s at 1.0 kV.
Resumo:
The formation and properties of carbonate adducts of some organic hydroxy compounds in aqueous medium were investigated. Fatty alcohols and sugars were chosen as representative classes of biological interest, and the medium was carbonated aqueous solution with pH ranging from 3.0 to 8.3. Capillary electrophoresis with two capacitively coupled contactless conductivity detectors (C4Ds) was used for quantitation and to obtain the mobility of the monoalkyl carbonates (MACs), which were used to determine the equilibrium and kinetic constants of the reaction as well as the diffusion coefficients. For increasing chain length of the alcohols, the equilibrium constant tends to the unit, which suggests that fatty alcohols can form the corresponding MACs. The formation of MACs for cyclohexanol and cyclopentanol also suggest the existence of similar species for sterols. Carbonate adducts of fructose, glucose, and sucrose were also detected, which suggests that these counterparts of the well-known phosphates can also occur in the cytosol. Our calculations suggest that one in 1000 to one in 10 000 molecules of these hydroxy compounds would be available as the corresponding MAC in such a medium. Experiments carried out at pH values less than 3.0 showed that there is a catalytic effect of hydronium on the interconversion of bicarbonate and a MAC. Taking into account the great number of hydroxy compounds similar to the ones investigated and that bicarbonate is ubiquitous in living cells, one can anticipate the existence of a whole new class of carbonate adducts of these metabolites.
Resumo:
Metabolomics has become an invaluable tool to unveil biology of pathogens, with immediate application to chemotherapy. It is currently accepted that there is not one single technique capable of obtaining the whole metabolic fingerprint of a biological system either due to their different physical-chemical properties or concentrations. In this work, we have explored the capability of capillary electrophoresis mass spectrometry with a sheathless interface with electrospray ionization (CE-ESI-TOF-MS) to separate metabolites in order to be used as a complementary technique to LC. As proof of concept, we have compared the metabolome of Leishmania infantum promastigotes BCN 150 (Sb (III) IC50 = 20.9 mu M) and its variation when treated with 120 mu M of Sb(III) potassium tartrate for 12 h, as well as with its Sb(III) resistant counterpart obtained by growth of the parasites under increasing Sb(III) in a step-wise manner up to 180 mu M. The number of metabolites compared were of 264 for BCN150 Sb(III) treated versus nontreated and of 195 for Sb(III) resistant versus susceptible parasites. After successive data filtering, differences in seven metabolites identified in databases for Leishmania pathways, showed the highest significant differences, corresponding mainly to amino acids or their metabolite surrogates. Most of them were assigned to sulfur containing amino acids and polyamine biosynthetic pathways, of special relevance considering the deterioration of the thiol-dependent redox metabolism in Leishmania by Sb(III). Given the low concentrations typical for most of these metabolites, the assay can be considered a success that should be explored for new biological questions.
Resumo:
A high-performance liquid chromatographic method using polar organic mode was developed to analyze albendazole (ABZ), albendazole sulfone (ABZSO(2)) and the chiral and active metabolite albendazole sulfoxide (ABZSOX, ricobendazole) that was further applied in stereoselective fungal biotransformation studies. The chromatographic separation was performed on a Chiralpak AS column using acetonitrile:ethanol (97:3, v/v) plus 0.2% triethylamine and 0.2% acetic acid as the mobile phase at a flow rate of 0.5 mL min(-1). The present study employed hollow fiber liquid-phase microextraction as sample preparation. The method showed to be linear over the concentration range of 25-5000 ng mL(-1) for each ABZSOX enantiomer, 200-10,000 ng mL(-1) for ABZ and 50-1000 ng mL(-1) for ABZSO(2) metabolite with correlation coefficient (r)> 0.9934. The mean recoveries for ABZ, rac-ABZSOX and ABZSO(2) were, respectively, 9%, 33% and 20% with relative standard deviation below 10%. Within-day and between-day precision and accuracy assays for these analytes were studied at three concentration levels and were lower than 15%. This study opens the door regarding the possibility of using fungi in obtaining of the active metabolite ricobendazole. Nigrospora sphaerica (Sacc.) E. W. Mason (5567), Pestalotiopsis foedans (VR8), Papulaspora immersa Hotson (SS13) and Mucor rouxii were able to stereoselectively metabolize ABZ into its chiral metabolite. Among them, the fungus Mucor rouxii was the most efficient in the production of (+)-ABZSOX. (C) 2011 Elsevier B.V. All rights reserved.
Development of Nanoinjector Devices for Electrospray Ionization - Tandem Mass Spectrometry (ESI-MSn)
Resumo:
In mass spectrometric (MS) systems with electrospray ionization (ESI), the sample can be analyzed coupled to separation systems (such as liquid chromatography or capillary electrophoresis) or simply by direct infusion. The greatest benefit of the type of injection is the possibility of continuous use of small amounts of samples over a long period of time. This extended analysis time allows a complete study of fragmentation by mass spectrometry, which is critical for structure elucidation of new compounds, or when using an ion trap mass analyzer. The injector filled with the sample is placed at the ESI source inlet creating an electric field suitable for the continuous formation of a spray (solvent and sample) and consequently, the gradual and even release of the sample. For the formation of the spray, is necessary that the injector end is metalized. The formation of a bilayer of titanium and gold provided an excellent attachment of the film, resulting in a nanoinjector for ionization/spray formation in the system for MS. The nanoinjectors showed high repeatability and stability over 100 min by continuous sampling with 10 mu L of sample.
Resumo:
A fast and sensitive method for the simultaneous determination of Sudan dyes (I, II, III, and IV) in food samples was developed for the first time using partial filling micellar electrokinectic chromatography-mass spectrometry (MEKC-MS). The use of MEKC was essential to achieve the separation of these neutral analytes, while the partial filling technique was necessary to avoid the contamination of the ion source with non-volatile micelles. MEKC separation and MS detection conditions were optimized in order to achieve a fast, efficient, and sensitive separation of the four dyes. Filling 25% of the capillary with an MEKC solution containing 40 mM ammonium bicarbonate, 25 mM SDS, and 32.5% (v/v) acetonitrile, a baseline separation of the four azo-dyes was obtained in 10 min. Tandem MS was investigated in order to improve the sensitivity and selectivity of the analysis. Limits of detection (LOD) values 5, 8, 15, and 29 times better were obtained for Sudan III, I, II, and IV, respectively, using partial filling MEKC-MS/MS instead of partial filling MEKC-MS. Under optimized conditions, LOD from 0.05 to 0.2 mu g/mL were obtained. The suitability of the developed method was demonstrated through the fast and sensitive determination of Sudan I, II, III, and IV in spiked chilli powder samples. This determination could not be achieved by MEKC-UV due to the existence of several interfering compounds from the matrix.
Resumo:
Carvedilol is an antihypertensive drug available as a racemic mixture. (-)-(S)-carvedilol is responsible for the nonselective beta-blocker activity but both enantiomers present similar activity on a1-adrenergic receptor. To our knowledge, this is the first study of carvedilol enantiomers in human plasma using a chiral stationary phase column and liquid chromatography with tandem mass spectrometry. The method involves plasma extraction with diisopropyl ether using metoprolol as internal standard and direct separation of the carvedilol enantiomers on a Chirobiotic T (R) (Teicoplanin) column. Protonated ions [M + H]+ and their respective ion products were monitored at transitions of 407 > 100 for the carvedilol enantiomers and 268 > 116 for the internal standard. The quantification limit was 0.2 ng ml-1 for both enantiomers in plasma. The method was applied to study enantioselectivity in the pharmacokinetics of carvedilol administered as a single dose of 25 mg to a hypertensive patient. The results showed a higher plasma concentration of (+)-(R)-carvedilol (AUC08 205.52 vs. 82.61 (ng h) ml-1), with an enantiomer ratio of 2.48. Chirality, 2012. (C) 2012 Wiley Periodicals, Inc.