944 resultados para Border barrier
Resumo:
The objective of the present study was to investigate the effects of recombinant human growth hormone (rhGH) on the intestinal mucosa barrier of septic rats and explore its possible mechanism. Female Sprague-Dawley rats were randomized into three groups: control, Escherichia coli-induced sepsis (S) and treatment (T) groups. Groups S and T were subdivided into subgroups 1d and 3d, respectively. Expression of liver insulin-like growth factor-1 (IGF-1) mRNA, Bcl-2 and Bax protein levels and the intestinal Bax/Bcl-2 ratio, and plasma GH and IGF-1 levels were determined. Histological examination of the intestine was performed and bacterial translocation was determined. rhGH significantly attenuated intestinal mucosal injuries and bacterial translocation in septic rats, markedly decreased Bax protein levels, inhibited the decrease of Bcl-2 protein expression and maintained the Bax/Bcl-2 ratio in the intestine. rhGH given after sepsis significantly improved levels of plasma GH (T1d: 1.28 ± 0.24; T3d: 2.14 ± 0.48 µg/L vs S1d: 0.74 ± 0.12; S3d: 0.60 ± 0.18 µg/L; P < 0.05) and IGF-1 (T1d: 168.94 ± 65.67; T3d: 201.56 ± 64.98 µg/L vs S1d: 116.72 ± 13.96; S3d: 107.50 ± 23.53 µg/L; P < 0.05) and expression of liver IGF-1 mRNA (T1d: 0.98 ± 0.20; T3d: 1.76 ± 0.17 vs S1d: 0.38 ± 0.09; S3d: 0.46 ± 0.10; P < 0.05). These findings indicate that treatment with rhGH had beneficial effects on the maintenance of the integrity of the intestinal mucosa barrier in septic rats.
Resumo:
The objectives of this study were to determine the effect of tumor necrosis factor alpha (TNF-α) on intestinal epithelial cell permeability and the expression of tight junction proteins. Caco-2 cells were plated onto Transwell® microporous filters and treated with TNF-α (10 or 100 ng/mL) for 0, 4, 8, 16, or 24 h. The transepithelial electrical resistance and the mucosal-to-serosal flux rates of the established paracellular marker Lucifer yellow were measured in filter-grown monolayers of Caco-2 intestinal cells. The localization and expression of the tight junction protein occludin were detected by immunofluorescence and Western blot analysis, respectively. SYBR-Green-based real-time PCR was used to measure the expression of occludin mRNA. TNF-α treatment produced concentration- and time-dependent decreases in Caco-2 transepithelial resistance and increases in transepithelial permeability to the paracellular marker Lucifer yellow. Western blot results indicated that TNF-α decreased the expression of phosphorylated occludin in detergent-insoluble fractions but did not affect the expression of non-phosphorylated occludin protein. Real-time RT-PCR data showed that TNF-α did not affect the expression of occludin mRNA. Taken together, our data demonstrate that TNF-α increases Caco-2 monolayer permeability, decreases occludin protein expression and disturbs intercellular junctions.
Resumo:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Resumo:
The liberalisation of the wholesale electricity markets has been considered an efficient way to organise the markets. In Europe, the target is to liberalise and integrate the common European electricity markets. However, insufficient transmission capacity between the market areas hampers the integration, and therefore, new investments are required. Again, massive transmission capacity investments are not usually easy to carry through. This doctoral dissertation aims at elaborating on critical determinants required to deliver the necessary transmission capacity investments. The Nordic electricity market is used as an illustrative example. This study suggests that changes in the governance structure have affected the delivery of Nordic cross-border investments. In addition, the impacts of not fully delivered investments are studied in this doctoral dissertation. An insufficient transmission network can degrade the market uniformity and may also cause a need to split the market into smaller submarkets. This may have financial impacts on market actors when the targeted efficient sharing of resources is not met and even encourage gaming. The research methods applied in this doctoral dissertation are mainly empirical ranging from a Delphi study to case studies and numerical calculations.
Resumo:
The European ambitious targets to increase the share of renewable generation pose a challenge to the generation adequacy. Many European member states are concerned that energy-only markets alone might not be able to deliver sufficient capacity required to meet the future electricity demand and back up shortfalls of energy from renewable energy sources (RES) during periods of low wind and sun. Many EU members consider to re-design their energy-only markets and establish different forms of capacity remunerative mechanisms (CRMs) to maintain the security of supply. There is a certain concern that market design changes at the level of EU member countries might conflict with the European goal of a single market. As soon as many European markets are highly interconnected, uncoordinated CRMs might create negative crossborder effects and hinder the achievement of the Internal Electricity Market in Europe. The pros and cons of capacity markets are well examined at the national level. However, the cross-border effects of capacity markets within the European market aiming at higher integration have received less attention. This doctoral dissertation examines the cross-border effects of unilateral implementation of CRMs applying both theoretical and case study analyses. The results show that capacity remunerative mechanisms (CRMs) may cause negative cross-border effects, especially if they are implemented unilaterally.