955 resultados para Boiler fly ash


Relevância:

40.00% 40.00%

Publicador:

Resumo:

In this study, equations for the calculation of erosion wear caused by ash particles on convective heat exchanger tubes of steam boilers are presented. Anew, three-dimensional test arrangement was used in the testing of the erosion wear of convective heat exchanger tubes of steam boilers. When using the sleeve-method, three different tube materials and three tube constructions could be tested. New results were obtained from the analyses. The main mechanisms of erosionwear phenomena and erosion wear as a function of collision conditions and material properties have been studied. Properties of fossil fuels have also been presented. When burning solid fuels, such as pulverized coal and peat in steam boilers, most of the ash is entrained by the flue gas in the furnace. In bubbling andcirculating fluidized bed boilers, particle concentration in the flue gas is high because of bed material entrained in the flue gas. Hard particles, such as sharp edged quartz crystals, cause erosion wear when colliding on convective heat exchanger tubes and on the rear wall of the steam boiler. The most important ways to reduce erosion wear in steam boilers is to keep the velocity of the flue gas moderate and prevent channelling of the ash flow in a certain part of the cross section of the flue gas channel, especially near the back wall. One can do this by constructing the boiler with the following components. Screen plates can beused to make the velocity and ash flow distributions more even at the cross-section of the channel. Shield plates and plate type constructions in superheaters can also be used. Erosion testing was conducted with three types of tube constructions: a one tube row, an inline tube bank with six tube rows, and a staggered tube bank with six tube rows. Three flow velocities and two particle concentrations were used in the tests, which were carried out at room temperature. Three particle materials were used: quartz, coal ash and peat ash particles. Mass loss, diameter loss and wall thickness loss measurements of the test sleeves were taken. Erosion wear as a function of flow conditions, tube material and tube construction was analyzed by single-variable linear regression analysis. In developing the erosion wear calculation equations, multi-variable linear regression analysis was used. In the staggered tube bank, erosion wear had a maximum value in a tube row 2 and a local maximum in row 5. In rows 3, 4 and 6, the erosion rate was low. On the other hand, in the in-line tube bank the minimum erosion rate occurred in tube row 2 and in further rows the erosion had an increasing value, so that in a six row tube bank, the maximum value occurred in row 6.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Työn tavoite oli kehittää karakterisointimenetelmät kalkkikiven ja polttoaineen tuhkan jauhautumisen ennustamiselle kiertoleijukattilan tulipesässä. Kiintoainekäyttäytymisen karakterisoinnilla ja mallintamisella voidaan tarkentaa tulipesän lämmönsiirron ja tuhkajaon ennustamista. Osittain kokeelliset karakterisointimenetelmät perustuvat kalkkikiven jauhautumiseen laboratoriokokoluokan leijutetussa kvartsiputkireaktorissa ja tuhkan jauhatumiseen rotaatiomyllyssä. Karakterisointimenetelmät ottavat huomioon eri-laiset toimintaolosuhteet kaupallisen kokoluokan kiertoleijukattiloissa. Menetelmät kelpoistettiin kaupallisen kokoluokan kiertoleijukattiloista mitattujen ja fraktioittaisella kiintoainemallilla mallinnettujen taseiden avulla. Kelpoistamistaseiden vähäisyydestä huolimatta karakterisointimenetelmät arvioitiin virhetarkastelujen perusteella järkeviksi. Karakterisointimenetelmien kehittämistä ja tarkentamista tullaan jatkamaan.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Programa Doutoral em Engenharia Mecânica.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Since insect species are poikilothermic organisms, they generally exhibit different growth patterns depending on the temperature at which they develop. This factor is important in forensic entomology, especially for estimating postmortem interval (PMI) when it is based on the developmental time of the insects reared in decomposing bodies. This study aimed to estimate the rates of development, viability, and survival of immatures of Sarcophaga (Liopygia) ruficornis (Fabricius 1794) and Microcerella halli (Engel 1931) (Diptera: Sarcophagidae) reared in different temperatures: 10, 15, 20, 25, 30, and 35 ± 1 °C. Bovine raw ground meat was offered as food for all experimental groups, each consisting of four replicates, in the proportion of 2 g/larva. To measure the evolution of growth, ten specimens of each group were randomly chosen and weighed every 12 h, from initial feeding larva to pupae, and then discarded. Considering the records of weight gain, survival rates, and stability of growth rates, the range of optimum temperature for the development of S. (L.) ruficornis is between 20 and 35 °C, and that of M. halli is between 20 and 25 °C. For both species, the longest times of development were in the lowest temperatures. The survival rate at extreme temperatures (10 and 35 °C) was lower in both species. Biological data such as the ones obtained in this study are of great importance to achieve a more accurate estimate of the PMI.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Biomass Refinery is a sequential of eleven thermochemical processes and one biological process with two initial basic treatments: prehydrolysis for lignocellulosics and low temperature conversion for biomass with medium-to-high content of lipids and proteins. The other ten processes are: effluent treatment plant, furfural plant, biodiesel plant, cellulignin dryer, calcination, fluidized bed boiler, authotermal reforming of cellulignin for syngas production, combined cycle of two-stroke low-speed engine or syngas turbine with fluidized bed boiler heat recovery, GTL technologies and ethanol from cellulose, prehydrolysate and syngas. Any kind of biomass such as wood, agricultural residues, municipal solid waste, seeds, cakes, sludges, excrements and used tires can be processed at the Biomass Refinery. Twelve basic products are generated such as cellulignin, animal feed, electric energy, fuels (ethanol, crude oil, biodiesel, char), petrochemical substitutes, some materials (ash, gypsum, fertilizers, silica, carbon black) and hydrogen. The technology is clean with recovery of energy and reuse of water, acid and effluents. Based on a holistic integration of various disciplines Biomass Refinery maximizes the simultaneous production of food, electric energy, liquid fuels and chemical products and some materials, achieving a competitive position with conventional and fossil fuel technologies, as well as payment capacity for biomass production. Biomass Refinery has a technical economical capability to complement the depletion of the conventional petroleum sources and to capture its GHGs resulting a biomass + petroleum ""green"" combination.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Demands for optimal boiler performance and increased concerns in lowering emission have always been the driving force in the reevaluation and evolution of the Kraft boiler: specifically the air distribution strategies that are directly related to achieving increased residence time of flue gas combustion inside the furnace which in turn lowers atmosphere emission levels and enhances boiler operation. This paper presents the results of a study that analyzes the interaction of the different multilevel air injections have on flue gas flow patterns including various quaternary air supply arrangements. Additionally, this study assesses the performance of the CFD (Computational Fluid Dynamics) model against data available in literature. Simulations were performed considering isothermal and incompressible flows, and did not take into account thermal phenomena or chemical reactions. The numerical solutions generated proved to be coherently related to the data available in literature, and provided proof of the efficiency of tertiary level air injection, as well as revealed that quaternary air injection ports arranged in a symmetrical configuration is most suitable for optimal equipment operation. (C) 2010 Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Bovine bone ash is the main raw material for fabrication of bone china, a special kind of porcelain that has visual and mechanical advantages when compared to usual porcelains. The properties of bone china are highly dependent on the characteristics of the bone ash. However, despite a relatively common product, the science behind formulations and accepted fabrication procedures for bone china is not completely understood and deserves attention for future processing optimizations. In this paper, the influence of the preparation steps (firing, milling, and washing of the bones) on the physicochemical properties of bone ash particles was investigated. Bone powders heat-treated at temperatures varying from 700 to 1000 degrees C were washed and milled. The obtained materials were analyzed in terms of particle size distribution, chemical composition, density, specific surface area, FTIR spectroscopy, dynamic electrophoretic mobility, crystalline phases and scanning electron microscopy. The results indicated that bone ash does not significantly change in terms of chemistry and physical features at calcination temperatures above 700 degrees C. After washing in special conditions, one could only observe hydroxyapatite in the diffraction pattern. By FTIR it was observed that carbonate seems to be mainly concentrated on the surface of the powders. Since this compound can influence in the dispersion stability, and consequently in the quality of the final bone china product, and considering optimal washing parameters based on the dynamic electrophoretic mobility results, we describe a procedure for surface cleaning. (c) 2009 Elsevier Ltd and Techna Group S.r.l. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A likely pathway to the sex pheromones of Bactrocera oleae (olive fruit-fly) is presented, based mainly on feeding experiments with deuterium labelled precursors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective To determine the efficacy of zeta-cypermethrin in controlling buffalo fly (Haematobia irritans exigua). Design Five field trials in northern and central Queensland. Procedure Zeta-cypermethrin pour-on at 2.5 mg/kg, spray at 62.5 ppm, deltamethrin pour-on and pour-on vehicle were applied to groups of 20 cattle. Buffalo fly counts were conducted three times before treatment and 3, 7, 14, 21, 28 and 35 days after treatment. Results In central Queensland where synthetic pyrethroid resistance in buffalo fly populations was rare, 2.5 mg/kg of zeta-cypermethrin pour-on gave good control of buffalo fly for 4 weeks and was better than a deltamethrin product. A zeta-cypermethrin spray used at 62.5 ppm gave 14 days control. In far-north Queensland where resistance to synthetic pyrethroids and heavy rain was common, the maximum period of efficacy of zeta-cypermethrin pour-on was reduced to 2 weeks. Conclusion In areas where there is low resistance to synthetic pyrethroids among buffalo flies, zeta-cypermethrin pour-on can be expected to give good control for 4 weeks.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The demonstration that both oxygen atoms of 1,7-dioxaspiro[5.5] undecane (1), the sex-pheromone of the female olive fly, originate from dioxygen, strongly implicates monooxygenase mediated processes in assembly of (1), and reveals unexpected complexity in the formation of its nine-carbon precursor.