Sintomatologia depressiva e avaliação de níveis de TNFα IL-2 em indivíduos idosos e com doença pulmonar obstrutiva crônica

The aim of the present study was to assess the presence of depressive symptomatology among elderly residents in long-stay institutions (LSI) and in the community of Recife, Brazil. In total, 81 long-stay elderly patients (mean age of 75.55 ± 9.18 years) and 132 elderly (mean age of 73.14 ± 8.27 years) individuals from the community were evaluated. Depressive symptomatology was assessed by the Geriatric Depression Scale (GDS-15), cognitive status by the Mini Mental State Examination (MMSE) and capacity to perform the activities of daily living (ADL) by the Katz Index. Comorbities and the use of medication were recorded. The LSI elderly exhibited more depressive symptoms (p < 0.001) and more dependency (p< 0.001). We observed no differences in MMSE (p = 0.058). The elderly in the community displayed more comorbidities and the LSI elderly consumed more medication (p < 0.001 and p < 0.001, respectively). According to multivariate analysis (logistic regression), being male, having no spouse and having a low schooling level are risk factors for depressive symptoms. In conclusion, most elderly with depressive symptoms received no medication fordepression.

Diagnóstico molecular da talassemia ALFA+ (DELEÇÃO -3.7) em indivíduos com microcitose e/ou hipocromia

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Diagnóstico molecular da talassemia ALFA em indivíduos com microcitose e/ou hipocromia

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior

Avaliação dos níveis séricos de 17-alfa-OH progesterona e androstenediona durante o ciclo estral em marrãs (Sus Scrofa Domestica - Linnaeus, 1758)

No presente trabalho, foram utilizadas 21 fêmeas suínas, virgens, sexualmente aptas, criadas e mantidas sob condições industriais, para observação dos perfis hormonais séricos de 17-alfa-OH progesterona e androstenediona, durante o ciclo estral. As colheitas de sangue foram efetuadas sempre no mesmo intervalo, entre 8 e 10 horas. Cada animal foi submetido a 14 punções venosas, distribuídas nos dias zero, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 21, 22 e 23 do ciclo estral. Considerou-se o dia zero como o primeiro dia da fase estral, e o 23º dia como o primeiro do estro subseqüente. Os ensaios para dosagens hormonais foram executados utilizando-se a técnica de radioimunoensaio (RIE) em fase sólida e para isso foi empregado conjunto de reagentes comerciais (Coat-A-Count®). Para o hormônio 17-alfa-OH progesterona, foram encontrados valores médios que variaram entre 0,18 e 2,7 ng/ml e para o hormônio androstenediona esses valores oscilaram entre 0,08 e 0,24 ng/ml.

Efeito do ácido alfa-lipóico sobre biomarcadores de estresse oxidativo, inflamação e fatores de risco cardiovascular em hipertensos

Alpha-lipoic acid (ALA) is a potent antioxidant with favourable anti-inflammatory, metabolic and endothelial effects, and has been widely investigated due to its potential against cardiovascular risk factors. This study aimed to evaluate the effect of oral ALA supplementation on oxidative stress biomarkers, inflammation and cardiovascular risk factors in patients with hypertension. This is a double-blind placebo-controlled randomized clinical trial, where the intervention was evaluated prospectively comparing results in both groups. The sample consisted of 64 hypertensive patients who were randomly distributed into ALA group (n = 32), receiving 600 mg / day ALA for twelve weeks and control group (n = 32), receiving placebo for the same period. The following parameters were evaluated before and after intervention: lipid peroxidation, content of reduced glutathione (GSH), enzymatic activities of glutathione peroxidase (GPx) and superoxide dismustase, ultrasensitive C-reactive protein (hs-CRP), triglycerides, total cholesterol and fractions, fasting glucose and anthropometric indicators. There was a statistically significant reduction (p <0.05) in serum concentrations of total cholesterol, very low density lipoprotein (VLDL), high density lipoprotein (HDL), triglycerides and blood glucose. There was a reduction in body weight and waist, abdominal and hip circumferences in the group that received ALA. In addition, there was a statistically significant increase (p <0.05) in the contents of reduced glutathione (GSH) and glutathione peroxidase (GPx) in the group receiving ALA. Oral administration of ALA appears to be a valuable adjuvant therapy, which may contribute to decrease the damage caused by oxidative stress and other risk factors associated with the atherosclerotic process

Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho

Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.

Comportamento elétrico a alta temperatura de termistor cerâmico alfa-Fe2O3 com coeficiente de temperatura negativo

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

TNF-alpha, H2O2 and NO response of peritoneal macrophages to Yersinia enterocolitica O : 3 derivatives

In this study, the effect of Yersinia derivatives on nitric oxide (NO), hydrogen peroxide (H2O2) and tumor necrosis factor-alpha (TNF-alpha) production by murine peritoneal macrophages was investigated. Addition of lipopolysaccharide (LPS) to the macrophage culture resulted in NO production that was dose dependent. on the other hand, bacterial cellular extract (CE) and Yersinia outer proteins (Yops) had no effect on NO production. The possible inhibitory effect of Yops on macrophage cultures stimulated with LPS was investigated. Yops partially inhibited NO production (67.4%) when compared with aminoguanidine. The effects of Yersinia derivatives on H2O2 production by macrophages were similar to those on NO production. LPS was the only derivative that stimulated H2O2 release in a dose-dependent manner. All Yersinia derivatives provoked the production of TNF-alpha, but LPS had the strongest effect, as observed for NO production. CE and Yops stimulated TNF-alpha production to a lesser extent than LPS. The results indicate the possibility that in vivo Yops may aid the evasion of the bacteria from the host defense mechanism by impairing the secretion of NO by macrophages. (C) 2003 Elsevier SAS. All rights reserved.

Expressão imuno-histoquímica do cd8, foxp3, Tgf β, tnf α e nf-кb em displasias epiteliais e Carcinomas epidermóides orais

The Oral Epithelial Dysplasia (OED) is the lesion that precedes or co-exists with the Oral Squamous Cell Carcinoma (OSCC), presenting molecular and/or histological similar alterations. The divergences about the malignization potential of OEDs and the role of inflammation in this process make hard the early diagnosis and evaluation of OSCCs aggressiveness. Thus, it became the goal of this study to evaluate the role of inflammation in oral carcinogenesis and tumoral aggressiveness. For this purpose a morphological study was performed in 20 OED cases and 40 OSCC cases to detect the malignization potential of OEDs and the histologic malignancy grading (HMG) of OSCCs, analyzing superficial masses for dismorphism evaluation and the invasive front for evaluation of tumoral growing; and immunohistochemical, using anti-CD8, anti-FOXP3, anti-TGFβ, anti-TNFα and anti-NF-кB antibodies, comparing their with the types lesion, histological degree and intensity of the inflammatory infiltrate. The results were statistically significant for the parameters: cell maturity (p=0,0001), masses presence (p=0,038) and dismorphism (p=0,037), when associated to HMG. To compare the expression of the markers with the types lesion, a significantly higher expression of CD8 (p=0,001) and NF-кB (p=0,002) in the OED, and also a smaller expression of the epithelial TGFβ in the severe OEDs (p=0,011), without significant expression between OSCC degrees. By relating the expression of the studied markers with the inflammatory infiltrate intensity, a positive relation was observed with: inflammatory TNFα(p=0,003), epithelial TNFα and NF-кB (p=0,051 and p=0,004), in OEDs; and with CD8 (p=0,021) and TNFα (p=0,015) in conjunctive OSCCs; and a negative relation with epithelial TNFα (p=0,034) in OSCCs. No significant relation was found between FOXP3 with any of the studied variables. These findings lead to the conclusion that, the study of the invasive front is as important as the study of superficial masses for the evaluation of tumoral aggressiveness; the intensity of the inflammatory infiltrate has no use as a parameter for prognostic evaluation of OSCC in routine exams, but, the molecular events detected in this study may be necessary to give basis for determining the malignant potential in OEDs and aggressiveness in OSCCs

Imunoexpressão de fatores reguladores da osteoclastogênese na doença periodontal em humanos e sua relação com os parâmetros clínicos

Periodontal disease is an infection initiated by oral periodontal pathogens that trigger an immune response culminating in tissue destruction. This destruction is mediated by the host by inducing the production and activation of lytic enzymes, cytokines and the stimulation of osteoclastogenesis. The aim of this study was to compare the immunohistochemical expression of factors involved in bone resorption, RANKL (Ligand Receptor Activator of Nuclear Factor kappa B), OPG (Osteoprotegerin) and TNF-α (tumor necrosis factor alpha) between the gingival healthy, gingivitis and chronic periodontitis and correlate them with clinical parameters. The sample consisted of 83 cases and 12 clinically healthy gums, 42 gingivitis and 29 periodontitis, from 74 adolescent and adult patients with a mean age of 35 years, without systemic changes and non-smokers, predominantly female and race brown. There was no statistically significant difference for the expression of anti-RANKL (p = 0.581) and RANKL / OPG ratio (p = 0.334) when comparing the three conditions, but the anti-OPG and anti-TNF-α showed statistically significant between the types of injury (p = 0.001 and p <0.001, respectively), showing greatest expression in periodontitis. In cases of periodontitis, the variable clinical attachment loss (PIC) was statistically significant and positive correlation, respectively, with immunostaining of anti-RANKL (p = 0.002, p = 0.001 and r = 0.642), anti-OPG (p = 0.018, p = 0.014 and r = 0.451), anti-TNF-α (p = 0.032, p = 0.014 and r = 0.453) and the percentage ratio of RANKL / OPG (p = 0.018, p = 0.002 and r = 0.544). The tooth mobility (MB) showed a statistically significant difference only with immunohistochemical anti-RANKL (p = 0.026), and probing depth (PD) was positively correlated with anti-RANKL (p = 0.028 and r = 0.409), both in cases of periodontitis. Only in cases of gingivitis TNF-α was positively correlated with RANKL (p = 0.012 and r = 0.384) and the RANKL / OPG ratio (p = 0.027 and r = 0.341). Given these results, we conclude that the greatest expression of TNF-α in periodontitis demonstrates a relationship with the progression and severity of periodontal disease and the correlation between all antibodies and clinical attachment loss demonstrates their involvement in periodontal bone resorption

Glia-Pinealocyte Network: The Paracrine Modulation of Melatonin Synthesis by Tumor Necrosis Factor (TNF)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Prevalência de talassemia alfa+ (deleção -3.7) na população adulta do estado do Rio Grande do Norte

Alpha thalassemia, the most common monogenic disorder in the world, is characterized by deletions of one (+-thalassemia) or both alpha genes (0-thalassemia) located on human chromosome 16 (16p13.3). The most common case of +-thalassemia is a deletion of 3.7 kb of DNA (-3.7 deletion). It is most prevalent in African and Middle East regions. In the few studies carried out in Brazilian population -3.7 deletion was the most common deletion, mainly in African descendants. This study was conducted to determine the prevalence of +- thalassemia (deletion 3.7kb) in adult population from Rio Grande do Norte. We obtained blood samples from 713 unrelated individuals of both genders, aged between 18 and 59 years old. All individuals were born in Rio Grande do Norte. The hematological indices were obtained in an automatic cell counter (Micros 60, ABX Diagnostics). The hemoglobin measurement (A2 and Fetal hemoglobin) and the profile confirmation were carried out by high performance liquid chromatography (HPLC) methodology. Genomic DNA was obtained from peripheral blood leukocytes using Illustra Blood GenomicPrep Mini Spin kit and -3.7 deletion was investigated by PCR. Among the 713 individuals studied, 80 (11,2%) presented +- thalassemia: 79 (11,1%) were heterozygous and 1 (0,1%) homozygous for the -3.7 deletion. Considering the ethnic group, negroes showed the greatest prevalence of +-thalassemia (12,5%), followed by mulattoes (12,3%) and caucasian (9,6%). Statistical comparison of hematological parameters between normal individuals and heterozygous to +-thalassemia showed significant differences in RBC (p<0,001), MCV (p<0,001), MCH (p<0,001), Hb A2 (p=0,007) as well as female hemoglobin concentration (p=0,003). This is one of the first studies to research +-thalassemia in general population of Rio Grande do Norte state and these results attest the importance of investigation of this condition to define the etiology of microcytosis and hypochromia.

Paracoccidioides brasifiensis killing by IFN-gamma, TNF-alpha and GM-CSF activated human neutrophils: role for oxygen metabolites

Paracoccidioidomycosis, a deep mycosis endemic in Latin America, is a chronic granulomatous disease caused by the fungus Paracoccidioides brasiliensis. Phagocytic cells play a critical role against the fungus and several papers show the effects of activator and suppressive cytokines on macrophage and monocyte functions. However, the studies focusing on polymorphonuclear neutrophils (PMNs) antifungal functions are scarcer. Thus, the objective of the present paper was to assess the capacity of human PMNs to kill virulent P brasiliensis strain in vitro, before and after priming with different cytokines. Moreover, the involvement of oxygen metabolites in this activity was evaluated. Nonactivated cells failed to exhibit antifungal activity. However, when these cells were IFN-gamma, TNF-alpha or GM-CSF activated, a significative fungicidal activity was detected. This process was significantly inhibited when P brasiliensis challenge occurred in presence of catalase (CAT - a scavenger of H2O2) and superoxide dismutase (SOD - a scavenger of superoxide anion). From these results it is concluded that cytokines activation is required for P brasiliensis killing by human PMNs, and that H2O2 and Superoxide anion participate as effectors molecules in this process.

Killing of Paracoccidioides brasiliensis yeast cells by IFN-gamma and TNF-alpha activated murine peritoneal macrophages: evidence of H(2)O(2) and NO effector mechanisms

Paracoccidioidomycosis is a deep mycosis, endemic in Latin America, caused by Paracoccidioides brasiliensis. Macrophage activation by cytokines is the major effector mechanism against this fungus. This work aimed at a better understanding of the interaction between yeast cells-murine peritoneal macrophages and the cytokine signals required for the effective killing of high virulence yeast-form of P. brasiliensis. In addition, the killing effector mechanisms dependent on the generation of reactive oxygen or nitrogen intermediates were investigated. Cell preincubation with IFN-gamma or TNF-alpha, at adequate doses, resulted in effective yeast killing as demonstrated in short-term (4-h) assays. Both, IFN-gamma and TNF-alpha activation were associated with higher levels of H(2)O(2) and NO when compared to nonactivation. Treatment with catalase (CAT), a H(2)O(2) scavenger, and N(G)-monomethyl-L-arginine (L-NMMA), a nitric oxide synthase inhibitor, reverted the killing effect of activated cells. Taken together, these results suggest that both oxygen and L-arginine-nitric oxide pathways play a role in the killing of highly virulent P. brasiliensis.

TNF-308G > A Single Nucleotide Polymorphism Is Associated With Leprosy Among Brazilians: A Genetic Epidemiology Assessment, Meta-Analysis, and Functional Study

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)