930 resultados para SAND FLY SALIVA
Resumo:
Friction coefficient (FC) was quantified between titanium-titanium (Ti-Ti) and titanium-zirconia (Ti-Zr), materials commonly used as abutment and implants, in the presence of a multispecies biofilm (Bf) or salivary pellicle (Pel). Furthermore, FC was used as a parameter to evaluate the biomechanical behavior of a single implant-supported restoration. Interface between Ti-Ti and Ti-Zr without Pel or Bf was used as control (Ctrl). FC was recorded using tribometer and analyzed by two-way Anova and Tukey test (p<0.05). Data were transposed to a finite element model of a dental implant-supported restoration. Models were obtained varying abutment material (Ti and Zr) and FCs recorded (Bf, Pel, and Ctrl). Maximum and shear stress were calculated for bone and equivalent von Misses for prosthetic components. Data were analyzed using two-way ANOVA (p<0.05) and percentage of contribution for each condition (material and FC) was calculated. FC significant differences were observed between Ti-Ti and Ti-Zr for Ctrl and Bf groups, with lower values for Ti-Zr (p<0.05). Within each material group, Ti-Ti differed between all treatments (p<0.05) and for Ti-Zr, only Pel showed higher values compared with Ctrl and Bf (p<0.05). FC contributed to 89.83% (p<0.05) of the stress in the screw, decreasing the stress when the FC was lower. FC resulted in an increase of 59.78% of maximum stress in cortical bone (p=0.05). It can be concluded that the shift of the FC due to the presence of Pel or Bf is able to jeopardize the biomechanical behavior of a single implant-supported restoration.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
PURPOSE: This study evaluated the quality of DNA obtained from stored human saliva and its applicability to human identification. METHODS: The saliva samples of 20 subjects, collected in the form of saliva in natura and from mouth swabs and stored at -20ºC, were analyzed. After 7 days, the DNA was extracted from the 40 saliva samples and subjected to PCR and electrophoresis. After 180 days, the technique was repeated with the 20 swab samples. RESULTS: The first-stage results indicated that DNA was successfully extracted in 97.5% of reactions, 95% of saliva in natura and 100% of swab saliva samples, with no statistically significant difference between the forms of saliva. In the second phase, the result was positive for all 20 analyzed samples (100%). Subsequently, in order to analyze the quality of the DNA obtained from human saliva, the SIX3-2 gene was tested on the 20 mouth swab samples, and the PCR products were digested using the MbO1 restriction enzyme to evaluate polymorphisms in the ADRA-2 gene, with positive results for most samples. CONCLUSION: It was concluded that the quantity and quality of DNA from saliva and the techniques employed are adequate for forensic analysis of DNA.
Resumo:
This study evaluated in vitro the shear bond strength (SBS) of a resin-based pit-and-fissure sealant [Fluroshield (F), Dentsply/Caulk] associated with either an etch-and-rinse [Adper Single Bond 2 (SB), 3M/ESPE] or a self-etching adhesive system [Clearfil S3 Bond (S3), Kuraray Co., Ltd.] to saliva-contaminated enamel, comparing two curing protocols: individual light curing of the adhesive system and the sealant or simultaneous curing of both materials. Mesial and distal enamel surfaces from 45 sound third molars were randomly assigned to 6 groups (n=15), according to the bonding technique: I - F was applied to 37% phosphoric acid etched enamel. The other groups were contaminated with fresh human saliva (0.01 mL; 10 s) after acid etching: II - SB and F were light cured separately; III - SB and F were light cured together; IV - S3 and F were light cured separately; V - S3 and F were light cured simultaneously; VI - F was applied to saliva-contaminated, acid-etched enamel without an intermediate bonding agent layer. SBS was tested to failure in a universal testing machine at 0.5 mm/min. Data were analyzed by one-way ANOVA and Fisher's test (α=0.05).The debonded specimens were examined with a stereomicroscope to assess the failure modes. Three representative specimens from each group were observed under scanning electron microscopy for a qualitative analysis. Mean SBS in MPa were: I-12.28 (±4.29); II-8.57 (±3.19); III-7.97 (±2.16); IV-12.56 (±3.11); V-11.45 (±3.77); and VI-7.47 (±1.99). In conclusion, individual or simultaneous curing of the intermediate bonding agent layer and the resin sealant did not seem to affect bond strength to saliva-contaminated enamel. S3/F presented significantly higher SBS than the that of the groups treated with SB etch-and-rinse adhesive system and similar SBS to that of the control group, in which the sealant was applied under ideal dry, noncontaminated conditions.
Resumo:
OBJECTIVE: To determine if some stimulated whole saliva parameters are influenced by an increase of Body Mass Index. METHODS: Controlled cross-sectional study involving 90 school children of both genders between 7 and 10 years of age, from Bragança Paulista - SP. Three groups were formed: overweight, obese and control. Body Mass Index and diet intake by the Food Register method were evaluated. The salivary pH, flow rate, buffer capacity, protein, phosphate, calcium, fluoride, total and free sialic acid, and peroxidase activity were determined. RESULTS: The overweight and obese groups showed greater energy and lipid intake (P< 0.001) than the control group. There was no difference in the saliva flow rate between groups, however only the control group showed a mean value considered normal. In the overweight and obese groups a decrease in both the concentration of phosphate (P< 0.001) and peroxidase activity (P<0.001) was observed. In the obese group an increase in the concentrations of free sialic acid (P= 0.004) and protein (P= 0.003) occurred. CONCLUSION: Overweight and obese children show alterations in the concentrations of phosphate, free sialic acid and proteins, and in the peroxidase activity that are favorable conditions for dental caries.
Resumo:
The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.
Resumo:
On the first tachinid fly (Diptera, Tachinidae) carrying Asclepiadoideae pollinaria in the Neotropical Region. This paper reports the first Neotropical Tachinidae species possibly associated to pollination of Asclepiadoideae: a female of Euacaulona sumichrasti Townsend, 1908 (Diptera, Tachinidae, Phasiinae, Trichopodini) carrying pollinaria of Gonolobus parviflorus Decne., 1844 (Apocynaceae, Asclepiadoideae, Asclepiadeae: Gonolobinae) attached to its proboscis. The fly specimen was collected in Paraguay, Departamento Canindeyú. The pollinarium is illustrated and described herein. This represents the first anthophilous record to G. parviflorus and to the genus.
Resumo:
A new species of sand-dwelling catfish genus Pygidianops, P. amphioxus, is described from the Negro and lower Amazon basins. The new species differs from its three congeners in the elongate eel-like body, the short barbels, and the small caudal fin, continuous with the body, among other traits of internal anatomy. The absence of anal fin further distinguishes P. amphioxus from all other Pygidianops species except P. magoi and the presence of eyes from all except P. cuao. The new Pygidianops seems to be the sister species to P. magoi, the two species sharing a unique mesethmoid with a dorsally-bent tip lacking cornua, and a produced articular process in the palatine for the articulation with the neurocranium. Pygidianops amphioxus is a permanent and highly-specialized inhabitant of psammic environments. Additional characters are proposed as synapomorphies of Pygidianops, including a hypertrophied symphyseal joint and associated ligament in the lower jaw; an elongate, laterally-directed, process on the dorsal surface of the premaxilla; and a rotated lower jaw, where the surface normally facing laterally in other glanapterygines is instead directed ventrally. These and other characters are incorporated into a revised phylogenetic diagnosis of Pygidianops.
Resumo:
As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.
Resumo:
Homalodisca vitripennis ( Germar) ( Hemiptera: Cicadellidae), the glassy- winged sharpshooter, is one of the most important vectors of the bacterium, Xylella fastidiosa subsp. piercei ( Xanthomonadales: Xanthomonadaceae) that causes Pierce's Disease in grapevines in California. In the present study we report a new method for studying pathogen transmission or probing behavior of H. vitripennis. When confined, H. vitripennis attempt to probe the surface of sterile containers 48 hours post- acquisition of X. f. piercei. The saliva deposited during attempted feeding probes was found to contain X. f. piercei. We observed no correlation between X. f. piercei titers in the foregut of H. vitripennis that fed on Xylella- infected grapevines and the presence of this bacterium in the deposited saliva. The infection rate after a 48 h post- acquisition feeding on healthy citrus and grapevines was observed to be 77% for H. vitripennis that fed on grapevines and 81% for H. vitripennis that fed on citrus, with no difference in the number of positive probing sites from H. vitripennis that fed on either grapevine or citrus. This method is amenable for individual assessment of X. f. piercei- infectivity, with samples less likely to be affected by tissue contamination that is usually present in whole body extracts.
Resumo:
Early diagnosis of dengue virus (DENV) infection is important for patient management and control of dengue outbreaks. The objective of this study was to analyze the usefulness of urine and saliva samples for early diagnosis of DENV infection by real time RT-PCR. Two febrile patients, who have been attended at the General Hospital of the School of Medicine of Ribeirao Preto, Sao Paulo University were included in the study. Serum, urine and saliva samples collected from both patients were subjected to real time RT-PCR for DENV detection and quantification. Dengue RNA was detected in serum, urine and saliva samples of both patients. Patient 1 was infected with DENV-2 and patient 2 with DENV-3. Data presented in this study suggest that urine and saliva could be used as alternative samples for early diagnosis of dengue virus infection when blood samples are difficult to obtain, e.g.,in newborns and patients with hemorrhagic syndromes.
Resumo:
The highly expressed D7 protein family of mosquito saliva has previously been shown to act as an anti-inflammatory mediator by binding host biogenic amines and cysteinyl leukotrienes (CysLTs). In this study we demonstrate that AnSt-D7L1, a two-domain member of this group from Anopheles stephensi, retains the CysLT binding function seen in the homolog AeD7 from Aedes aegypti but has lost the ability to bind biogenic amines. Unlike any previously characterized members of the D7 family, AnSt-D7L1 has acquired the important function of binding thromboxane A(2) (TXA(2)) and its analogs with high affinity. When administered to tissue preparations, AnSt-D7L1 abrogated Leukotriene C(4) (LTC(4))-induced contraction of guinea pig ileum and contraction of rat aorta by the TXA(2) analog U46619. The protein also inhibited platelet aggregation induced by both collagen and U46619 when administered to stirred platelets. The crystal structure of AnSt-D7L1 contains two OBP-like domains and has a structure similar to AeD(7). In AnSt-D7L1, the binding pocket of the C-terminal domain has been rearranged relative to AeD7, making the protein unable to bind biogenic amines. Structures of the ligand complexes show that CysLTs and TXA(2) analogs both bind in the same hydrophobic pocket of the N-terminal domain. The TXA(2) analog U46619 is stabilized by hydrogen bonding interactions of the omega-5 hydroxyl group with the phenolic hydroxyl group of Tyr 52. LTC(4) and occupies a very similar position to LTE(4) in the previously determined structure of its complex with AeD7. As yet, it is not known what, if any, new function has been acquired by the rearranged C-terminal domain. This article presents, to our knowledge, the first structural characterization of a protein from mosquito saliva that inhibits collagen mediated platelet activation.
Resumo:
Background: Despite governmental and private efforts on providing malaria control, this disease continues to be a major health threat. Thus, innovative strategies are needed to reduce disease burden. The malaria vectors, through the injection of saliva into the host skin, play important role on disease transmission and may influence malaria morbidity. This study describes the humoral immune response against Anopheles (An.) darlingi saliva in volunteers from the Brazilian Amazon and addresses the association between levels of specific antibodies and clinical presentation of Plasmodium (P.) vivax infection. Methods: Adult volunteers from communities in the Rondonia State, Brazil, were screened in order to assess the presence of P. vivax infection by light microscopy and nested PCR. Non-infected volunteers and individuals with symptomatic or symptomless infection were randomly selected and plasma collected. An. darlingi salivary gland sonicates (SGS) were prepared and used to measure anti-saliva antibody levels. Plasma interleukin (IL)-10 and interferon (IFN)-gamma levels were also estimated and correlated to anti-SGS levels. Results: Individuals infected with P. vivax presented higher levels of anti-SGS than non-infected individuals and antibody levels could discriminate infection. Furthermore, anti-saliva antibody measurement was also useful to distinguish asymptomatic infection from non-infection, with a high likelihood ratio. Interestingly, individuals with asymptomatic parasitaemia presented higher titers of anti-SGS and lower IFN-gamma/IL-10 ratio than symptomatic ones. In P. vivax-infected asymptomatic individuals, the IFN-gamma/IL-10 ratio was inversely correlated to anti-SGS titers, although not for while in symptomatic volunteers. Conclusion: The estimation of anti-An. darlingi antibody levels can indicate the probable P. vivax infection status and also could serve as a marker of disease severity in this region of Brazilian Amazon.
Resumo:
Addressing spatial variability in nitrogen (N) availability in the Central Brazilian Amazon, we hypothesized that N availability varies among white-sand vegetation types (campina and campinarana) and lowland tropical forests (dense terra-firme forests) in the Central Brazilian Amazon, under the same climate conditions. Accordingly, we measured soil and foliar N concentration and N isotope ratios (delta(15)N) throughout the campina-campinarana transect and compared to published dense terra-firme forest results. There were no differences between white-sand vegetation types in regard to soil N concentration, C:N ratio and delta(15)N across the transect. Both white-sand vegetation types showed very low foliar N concentrations and elevated foliar C:N ratios, and no significant difference between site types was observed. Foliar delta(15)N was depleted, varying from -9.6 to 1.6aEuro degrees in the white-sand vegetations. The legume Aldina heterophylla had the highest average delta(15)N values (-1.5aEuro degrees) as well as the highest foliar N concentration (2.1%) while the non-legume species had more depleted delta(15)N values and the average foliar N concentrations varied from 0.9 to 1.5% among them. Despite the high variation in foliar delta(15)N among plants, a significant and gradual (15)N-enrichment in foliar isotopic signatures throughout the campina-campinarana transect was observed. Individual plants growing in the campinarana were significantly enriched in (15)N compared to those in campina. In the white-sand N-limited ecosystems, the differentiation of N use seems to be a major cause of variations observed in foliar delta(15)N values throughout the campina-campinarana transect.