990 resultados para Polarized-light microscopy


Relevância:

90.00% 90.00%

Publicador:

Resumo:

Promoted ignition tests and quench tests have been conducted and analysed for 3.2 mm aluminum rods in 99.995% oxygen. Tests have been conducted in oxygen pressures varying from 538 kPa to 773 kPa. Samples that self-extinguished or were quenched were selected for further analysis. The microstructure of the selected samples were analysed by electron microscopy, using energy dispersive spectrometry and electron back-scatter techniques, to identify and visualize, respectively, the species present. The grain structures of these samples were etched, viewed and photographed under polarized light by an optical microscope. From the micrographs produced by the post-test analysis, clearly defined boundaries between the oxide and the melted and resolidified metal have been observed. In both the melted and resolidified metal and the oxide layer, significant numbers of gas bubbles, solid inclusions and several diffuse oxide bubbles have been captured during the cooling process. It is concluded that convective movement is occurring within the molten drop and that analysis of quenched samples provides more useful information on the state of the burning droplet than samples allowed to cool slowly to room temperature. Recommendations are made regarding future investigations into aluminum burning, focusing on the transport of reactants through the liquid oxide layer.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

A plethora of techniques for the imaging of liposomes and other bilayer vesicles are available. However, sample preparation and the technique chosen should be carefully considered in conjunction with the information required. For example, larger vesicles such as multilamellar and giant unilamellar vesicles can be viewed using light microscopy and whilst vesicle confirmation and size prior to additional physical characterisations or more detailed microscopy can be undertaken, the technique is limited in terms of resolution. To consider the options available for visualising liposome-based systems, a wide range of microscopy techniques are described and discussed here: these include light, fluorescence and confocal microscopy and various electron microscopy techniques such as transmission, cryo, freeze fracture and environmental scanning electron microscopy. Their application, advantages and disadvantages are reviewed with regard to their use in analysis of lipid vesicles.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Ionic liquid crystals (ILCs) allow the combination of the high ionic conductivity of ionic liquids (ILs) with the supramolecular organization of liquid crystals (LCs). ILCs salts were obtained by the assembly of long-chained diketonylpyridinium cations of the type [HOO^(R(n)pyH)] + and BF_(4)^(-) , ReO_(4)^(-), NO_(3)^(-), CF_(3)SO_(3)^(-), CuCl_(4)^(2-) counter-ions. We have studied the thermal behavior of five series of compounds by differential scanning calorimetry (DSC) and hot stage polarized light optical microscopy (POM). All materials show thermotropic mesomorphism as well as crystalline polymorphism. X-ray diffraction of the [HOO^(R(12)pyH)][ReO_(4)] crystal reveals a layered structure with alternating polar and apolar sublayers. The mesophases also exhibit a lamellar arrangement detected by variable temperature powder X-ray diffraction. The CuCl_(4)^(2-) salts exhibit the best LC properties followed by the ReO_(4)^(-) ones due to low melting temperature and wide range of existence. The conductivity was probed for the mesophases in one species each from the ReO_(4)^(-) , and CuCl_(4)^(2-) families, and for the solid phase in one of the non-mesomorphic Cl^(-) salts. The highest ionic conductivity was found for the smectic mesophase of the ReO_(4)^(-) containing salt, whereas the solid phases of all salts were dominated by electronic contributions. The ionic conductivity may be favored by the mesophase lamellar structure.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Snakebite is a neglected disease and serious health problem in Brazil, with most bites being caused by snakes of the genus Bothrops. Although serum therapy is the primary treatment for systemic envenomation, it is generally ineffective in neutralizing the local effects of these venoms. In this work, we examined the ability of 7,8,3'-trihydroxy-4'-methoxyisoflavone (TM), an isoflavone from Dipteryx alata, to neutralize the neurotoxicity (in mouse phrenic nerve-diaphragm preparations) and myotoxicity (assessed by light microscopy) of Bothrops jararacussu snake venom in vitro. The toxicity of TM was assessed using the Salmonella microsome assay (Ames test). Incubation with TM alone (200 μg/mL) did not alter the muscle twitch tension whereas incubation with venom (40 μg/mL) caused irreversible paralysis. Preincubation of TM (200 μg/mL) with venom attenuated the venom-induced neuromuscular blockade by 84% ± 5% (mean ± SEM; n = 4). The neuromuscular blockade caused by bothropstoxin-I (BthTX-I), the major myotoxic PLA2 of this venom, was also attenuated by TM. Histological analysis of diaphragm muscle incubated with TM showed that most fibers were preserved (only 9.2% ± 1.7% were damaged; n = 4) compared to venom alone (50.3% ± 5.4% of fibers damaged; n = 3), and preincubation of TM with venom significantly attenuated the venom-induced damage (only 17% ± 3.4% of fibers damaged; n = 3; p < 0.05 compared to venom alone). TM showed no mutagenicity in the Ames test using Salmonella strains TA98 and TA97a with (+S9) and without (-S9) metabolic activation. These findings indicate that TM is a potentially useful compound for antagonizing the neuromuscular effects (neurotoxicity and myotoxicity) of B. jararacussu venom.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

It is well known that trichomes protect plant organs, and several studies have investigated their role in the adaptation of plants to harsh environments. Recent studies have shown that the production of hydrophilic substances by glandular trichomes and the deposition of this secretion on young organs may facilitate water retention, thus preventing desiccation and favouring organ growth until the plant develops other protective mechanisms. Lychnophora diamantinana is a species endemic to the Brazilian 'campos rupestres' (rocky fields), a region characterized by intense solar radiation and water deficits. This study sought to investigate trichomes and the origin of the substances observed on the stem apices of L. diamantinana. Samples of stem apices, young and expanded leaves were studied using standard techniques, including light microscopy and scanning and transmission electron microscopy. Histochemical tests were used to identify the major groups of metabolites present in the trichomes and the hyaline material deposited on the apices. Non-glandular trichomes and glandular trichomes were observed. The material deposited on the stem apices was hyaline, highly hydrophilic and viscous. This hyaline material primarily consists of carbohydrates that result from the partial degradation of the cell wall of uniseriate trichomes. This degradation occurs at the same time that glandular trichomes secrete terpenoids, phenolic compounds and proteins. These results suggest that the non-glandular trichomes on the leaves of L. diamantinana help protect the young organ, particularly against desiccation, by deposition of highly hydrated substances on the apices. Furthermore, the secretion of glandular trichomes probably repels herbivore and pathogen attacks.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Cuphea carthagenensis (Jacq.) J.F. Macbr. is an herb, which occurs preferably in wet places. Amongst other species of the genus, C. carthagenensis is distinguished for its great chemical potential and frequent use in popular medicine. In this study the morphological and anatomical structures were identified, as well as the histochemical characterization was done. Samples of root, stem and leaves were collected from adult plants. This material was processed for anatomical and histochemical analysis in light microscopy and for morphological analysis, in scanning electron microscopy. Important morphological and anatomical considerations were added for C. carthagenensis, such as: the occurrence of aerenchymatous phellem with suberized layers; the types of trichomes present in the vegetative organs, the characterization of secretory trichomes, as well as the secreted substances. The groups of secondary metabolites presents in the root, stem and leaf of C. carthagenensis with more intense histochemical reaction were: proanthocyanidins, phenolic compounds, acids polysaccharides (mucilage especially) and lipids.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The present work evaluated the effect of low doses of X-irradiation on the repairing process of sutured and nonsutured skin wounds in rats. For that, rats underwent a surgical proceedure, in which a 20 x 5-millimeter rectangular wound approximately 2-millimeter-deep was made in the dorsal region of each animal, and were divided in four groups: nonirradiated nonsutured; irradiated nonsutured ; nonirradiated sutured and irradiated sutured. The animals under irradiation were protected, during exposure, with a 2-millimeter-thick lead apron in such a way that only the incision was irradiated. Each animal was submitted to 18 seconds of exposure, undergoing a total of 7.4 rads. The evaluation of the effects of X-rays on the repairing process was carried out through microscopic observation by means of hematoxylin-eosin staining for morphological evaluation, and silver impregnation under polarized light for the observation of collagen synthesis. The results have shown that X-irradiation has caused delay in the repairing process, but it did not stop its development. The irradiated nonsutured group was considered to show the greater delay when compared with the other groups.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

It was done microencapsulation of natural essencial orange oil through spray-drying. The purpose was to use the best proportion of wall materials among maltodextrin, acacia gum, and modified starch (capsul) in order to retain greater amount of orange oil. The orange oil (10%) and maltodextrin (36%) remained constant. Three spray drying temperatures were employed: 180°C, 200°C and 220°C, therefore, nine final products were obtained. The superficial and inner oil concentrations were measured. The microcapsules were also examined through optical and scanning electron microscopy. The three temperatures employed did not affect the microencapsulation. The microstructure of the capsules were almost similar regardless the proportion employed among the carbohydrates to wall composition. At light microscopy it was observed a great heterogeneity of capsules diameters, and probably not smooth surfaces; at scanning electron microscopy it was clear that the walls displayed porosity over round surfaces. The best retention was given by the formula containing 10% of capsul, 10% of orange oil and 36% of maltodextrin, when total oil retention was 94%, regardless the drying temperature here employed.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

OBJETIVO: avaliar os efeitos da administração da associação zidovudina-lamivudina-ritonavir nos fígados e rins de ratas prenhes e seus conceptos do ponto de vista morfológico e fisiológico. MÉTODOS: 40 ratas albinas prenhes foram aleatoriamente divididas em 4 grupos: 1 controle (Ctrl: controle de veículo) e 3 experimentais (Exp1x, Exp3x e Exp9x). Estes últimos foram tratados por solução oral de zidovudina/lamivudina/ritonavir (Exp1x: 10/5/20 mg/kg; Exp3x: 30/15/60 mg/kg; Exp9x: 90/45/180 mg/kg). As drogas e o veículo foram administrados por gavagem, desde o 1º até o 20º dia de prenhez. No último dia do experimento, todos os animais foram anestesiados e sangue foi retirado da cavidade cardíaca para avaliação sérica das enzimas aspartato aminotransferase (AST) e alanina aminotransferase (ALT), por método calorimétrico, bem como da ureia, determinada por método cinético-enzimático, e creatinina, por método cinético-colorimétrico. Em seguida, fragmentos dos fígados e rins maternos e fetais foram coletados, fixados em formol a 10% e processados segundo os métodos histológicos para inclusão em parafina. Cortes com 5 µm de espessura foram corados pela hematoxilina-eosina (HE) e analisados por microscopia de luz. Na leitura das lâminas, considerou-se o padrão de normalidade para fígado e rins, tais como: hepatócitos, espaço porta íntegros e veias hepáticas bem definidas. Nos rins, a presença de corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Nos fígados fetais considerou-se, ainda, a morfologia das células da linhagem eritrocitária nas diferentes fases do desenvolvimento, bem como os megacariócitos. Quando houve alteração da coloração padrão estabelecida para as estruturas hepáticas e renais, alteração na morfologia de núcleos, rompimento de limites de alguma organela citoplasmática, presença de congestão vascular, tudo isso foi entendido como provavelmente provocado pelas drogas em sua(s) dose(s) de aplicação. A avaliação estatística foi realizada por análise de variância (ANOVA), completada pelo teste de Tukey-Kramer (p<0,05). RESULTADOS: os fígados maternos dos grupos Ctrl, Exp1x e Exp3x mostraram hepatócitos típicos, espaço porta íntegros e veias hepáticas com aspecto normal. No fígado materno do grupo Exp9x, foram encontrados hepatócitos com sinais de atrofia e apoptose (eosinofilia citoplasmática e núcleos picnóticos). Além disso, identificou-se vasodilatação dos capilares sinusoides (congestão). Os rins maternos dos grupos Ctrl e Exp1x apresentaram-se normais, com corpúsculos renais, túbulos contorcidos e alças de Henle típicos. Já nos grupos Exp3x e Exp9x, foram encontrados congestão vascular, glomérulos pequenos ricos em células contendo núcleos hipercromáticos, sendo mais intensos no Exp9x. Com relação aos fígados e rins fetais, não foram observadas alterações morfológicas ou fisiológicas nos grupos estudados. Encontrou-se aumento significante nos níveis da AST (305,70±55,80; p<0,05) e da creatinina (0,50±0,09; p<0,05) no grupo Exp9x. CONCLUSÕES: nossos resultados evidenciam que a administração da associação zidovudina/lamivudina/ritonavir a ratas prenhes em altas doses causa alterações morfológicas e funcionais nos fígados e rins maternos. Não houve alterações nem morfológicas nem fisiológicas nos fígados e rins fetais.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Lepidocharax, new genus, and Lepidocharax diamantina and L. burnsi new species from eastern Brazil are described herein. Lepidocharax is considered a monophyletic genus of the Stevardiinae and can be distinguished from the other members of this subfamily except Planaltina, Pseudocorynopoma, and Xenurobrycon by having the dorsal-fin origin vertically aligned with the anal-fin origin, vs. dorsal fin origin anterior or posterior to anal-fin origin. Additionally the new genus can be distinguished from those three genera by not having the scales extending over the ventral caudal-fin lobe modified to form the dorsal border of the pheromone pouch organ or to represent a pouch scale in sexually mature males. In this paper, we describe these two recently discovered species and the ultrastructure of their spermatozoa.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

With the great development of the gestational studies in all of the species, we noticed the necessity of adaptations of these techniques for prenatal diagnosis in dogs. Based on this, we studied the feasibility of chorion biopsy guided by ultrasound. Our results demonstrated accuracy on the sex determination being 2 males and 12 females, as well as it would be possible to identify chromosome alteration due to the quality of samplings. Sex determination was accomplished with the identification of Y gene chromosomes in PCR technique. After the collection, fragments were prepared for light microscopy studies and revealed fetal chorion tissue, blood colloid and erythrocyte. In the whole material we found hemosiderin impregnations due to the hemolysis and to the residue of blood of the placental marginal hematomes. The submitted female dogs to this technique demonstrated normal puppy births without death.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Aim: The aim of this study was to evaluate, by light microscopy, the effects of laser phototherapy (LPT) at 780nm or a combination of 660 and 790 nm, on the inflammatory process of the rat temporomandibular joint (TMJ) induced by carrageen. Background: Temporomandibular disorders (TMDs) are frequent in the population and generally present an inflammatory component. Previous studies have evidenced positive effects of laser phototherapy on TMDs. However, its mechanism of action on the inflammation of the TMJ is not known yet. Materials and Methods: Eighty-five Wistar rats were divided into 9 groups: G1, Saline; G2, Saline + LPT IR; G3, Saline + LPT IR + R; G4, Carrageenan; G5, Carrageenan + LPT IR; G6, Carrageenan + LPT IR + R; G7, previous LPT + Carrageenan; G8, previous LPT + carrageenan + LPT IR; and G9, previous LPT + carrageenan + LPT IR + R, and then subdivided in subgroups of 3 and 7 days. After animal death, specimens were taken, routinely cut and stained with HE, Sirius Red, and Toluidine Blue. Descriptive analysis of components of the TMJ was done. The synovial cell layers were counted. Results: Injection of saline did not produced inflammatory reaction and the irradiated groups did not present differences compared to non-irradiated ones. After carrageenan injection, intense inflammatory infiltration and synovial cell layers proliferation were observed. The infrared irradiated group presented less inflammation and less synovial cell layers number compared to other groups. Previous laser irradiation did not improve the results. Conclusion: It was concluded that the LPT presented positive effects on inflammatory infiltration reduction and accelerated the inflammation process, mainly with IR laser irradiation. The number of synovial cell layers was reduced on irradiated group.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

Three-dimensional spectroscopy techniques are becoming more and more popular, producing an increasing number of large data cubes. The challenge of extracting information from these cubes requires the development of new techniques for data processing and analysis. We apply the recently developed technique of principal component analysis (PCA) tomography to a data cube from the center of the elliptical galaxy NGC 7097 and show that this technique is effective in decomposing the data into physically interpretable information. We find that the first five principal components of our data are associated with distinct physical characteristics. In particular, we detect a low-ionization nuclear-emitting region (LINER) with a weak broad component in the Balmer lines. Two images of the LINER are present in our data, one seen through a disk of gas and dust, and the other after scattering by free electrons and/or dust particles in the ionization cone. Furthermore, we extract the spectrum of the LINER, decontaminated from stellar and extended nebular emission, using only the technique of PCA tomography. We anticipate that the scattered image has polarized light due to its scattered nature.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

AIM: To evaluate effects of pre- and postnatal protein deprivation and postnatal recovery on the myenteric plexus of the rat esophagus. METHODS: Three groups of young Wistar rats (aged 42 d) were studied: normal-fed (N42), protein-deprived (D42), and protein-recovered (R42). The myenteric neurons of their esophagi were evaluated by histochemical reactions for nicotinamide adenine dinucleotide (NADH), nitrergic neurons (NADPH)-diaphorase and acetylcholinesterase (AChE), immunohistochemical reaction for vasoactive intestinal polypeptide (VIP), and ultrastructural analysis by transmission electron microscopy. RESULTS: The cytoplasms of large and medium neurons from the N42 and R42 groups were intensely reactive for NADH. Only a few large neurons from the D42 group exhibited this aspect. NADPH detected in the D42 group exhibited low reactivity. The AChE reactivity was diffuse in neurons from the D42 and R42 groups. The density of large and small varicosities detected by immunohistochemical staining of VIP was low in ganglia from the D42 group. In many neurons from the D42 group, the double membrane of the nuclear envelope and the perinuclear cisterna were not detectable. NADH and NADPH histochemistry revealed no group differences in the profile of nerve cell perikarya (ranging from 200 to 400 mu m(2)). CONCLUSION: Protein deprivation causes a delay in neuronal maturation but postnatal recovery can almost completely restore the normal morphology of myenteric neurons. (C) 2010 Baishideng. All rights reserved.