Qualidade pós-colheita de caqui 'fuyu' com utilização de diferentes concentrações de cobertura comestível

One of the main objectives of applying edible coatings on fruits surface is to create a protective film to reduce weight loss due to evaporation and transpiration and also to decrease the risk of fruit rot caused by environmental contamination, in order to improve the visual aspect. Therefore, it is possible to increase shelf life, and decrease post harvest losses. Persimmon is a much appreciated fruit, with high potential for export, but sensitive to handling and storage. This study aimed to evaluate the effect of applying the edible coating Megh Wax ECF-124 (18% of active composts, consisting of emulsion of carnauba wax, anionic surfactant, preservative and water) produced by Megh Industry and Commerce Ltda in three different concentrations (25, 50 and 100%) on post harvest quality of 'Fuyu' persimmon stored for 14 days. The attributes evaluated for quality were: firmness, pH, acidity, soluble solids, weight loss and color. The results showed that application of carnauba wax in different concentrations was effective on decreasing weight loss of persimmon cv. Fuyu and maintenance of color aspects. Treatment at lower concentration, 25%, showed lower rate of discharge, but high concentrations showed lower values of mass loss. Carnauba wax application showed a high potential for use on postharvest conservation, and can be applied together with other technologies, helping to maintain quality for export.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Patterns of distribution and abundance of larval phosichthyidae (actinopterygii, stomiiformes) in southeastern Brazilian waters

Horizontal and vertical distribution patterns and abundance of larval phosichthyids were investigated from oblique and depth-stratified towns off Southeastern brazilian waters, from São Tomé cape (41ºW.; 22ºS.) to São Sebastião island (45ºW.; 24ºS.). The sampling was performed during two cruises (January/2002 -summer; August/2002 -winter). Overall 538 larvae of Phosichthyidae were collected during summer and 158 in the winter. Three species, Pollichthys mauli, Vinciguerria nimbaria and Ichthyioccoccus sp. occurred in the area, but Ichthyioccoccus sp. was extremely rare represented by only one specimen, caught in the oceanic region during the summer. Geographically, larval were concentrated in the oceanic region, and vertically distributed mainly between the surface and 80 m depth in the summer and winter. Larvae were more abundant during the night, performing a diel vertical migration in the water column. The results suggest that the meandering and eddies of Brazil Current play important role on the transport and distribution patterns of larval phosichthyids over the oceanic and neritic area in the Southeastern Brazil.

New data on the natural history and description of the immatures of Fulgeochlizus bruchi, a bioluminescent beetle from Central Brazil (Elateridae, Pyrophorini)

The mature larva and pupa of Fulgeochlizus bruchi (Candèze, 1896) are described and illustrated. Bioluminescent patterns are also given. Comments, new data on the first instar larva and natural history data are presented. The first instar larvae differ from the mature larvae mainly in their chaetotaxy, which is sparse and more symmetrically distributed.

Immatures of tapuruia Felisbertoi Lane, 1973 (Cerambycidae, Cerambycinae, Hexoplonini)

The larva and pupa of Tapuruia felisbertoi Lane, 1973, collected in Hevea brasiliensis (Euphorbiaceae) in Mato Grosso, Brazil, are described and illustrated. Biological data and a comparison with the larvae of other Hexoplonini species are also presented.

Immatures of Syphrea uberabensis guerini Bechyné (Coleoptera, Chrysomelidae, Alticini)

Immatures of Syphrea uberabensis guerini Bechyné (Coleoptera, Chrysomelidae, Alticini). Larva and pupa of Syphrea uberabensis guerini are described and illustrated for the first time and a comparison with the described immatures of other Alticini species from Neotropical region and also with Hermaeophaga mercurialis (Fabricius, 1792), from Palearctic region, is presented. Tibouchina stenocarpa (DC.) Cogn. (Melastomataceae) (quaresmeira-do-cerrado) is registered as a new host plant for this species of Alticini.

Immatures of Gratiana conformis (Boheman) (Coleoptera, Chrysomelidae, Cassidinae)

Egg cases and larvae of Gratiana conformis (Boheman, 1854) were collected on Solanum paniculatum L. and reared in laboratory. Egg case, egg, third instar and mature larvae and pupa are described and illustrated. Biological notes and a comparison with the immatures of other Gratiana species and Charidotis gemellata Boheman, 1855, are also presented.

Anopheles (Nyssorhynchus) atacamensis (Diptera: Culicidae), a new species from Northern Chile

Anopheles (Nyssorhynchus) atacamensis, a new species in the subgenus Nyssorhynchus, is described and validated using morphological characters of the male and female adult, male genitalia and immature stages. Molecular characterization employing sequences of the ITS2 rDNA and COI mtDNA are provided. The new taxon is compared with Anopheles (Nyssorhynchus) pictipennis (Philippi) from central Chile based on morphological features of the adults, male genitalia and larva. Illustrations of the diagnostic characteristics of the male genitalia, fourth-instar larva and pupa are provided.

New tick records in Rondônia, Western Brazilian Amazon

In the present study, we provide new tick records from Vilhena Municipality, in the Southeast of the State of Rondônia, Northern Brazil. Ticks collected from a capybara, Hydrochoerus hydrochaeris (Linnaeus), were identified as Amblyomma romitii Tonelli-Rondelli (1 female), and Amblyomma sp. (1 larva). Ticks collected from a harpy eagle, Harpia harpyja (Linnaeus), were identified as Amblyomma cajennense (Fabricius) (16 nymphs) and Haemaphysalis juxtakochi Cooley (1 nymph). Ticks collected from a yellow-footed tortoise, Chelonoidis denticulada (Linnaeus), were identified as Amblyomma rotundatum Koch (10 females, 2 nymphs), and Amblyomma sp. (2 larvae). The present record of A. romitii is the first in the State of Rondônia, and represents the southernmost record for this tick species, indicating that its distribution area is much larger than currently recognized. Although both A. cajennense and H. juxtakochi have been reported parasitizing various bird species, we provide the first tick records on a harpy eagle. A. rotundatum is widespread in the State of Rondônia, and has been previously reported on the yellow-footed tortoise. The present records increase the tick fauna of Rondônia to 26 species.

Estimação da infestação predial por Aedes aegypti (Díptera: Culicidae) por meio da armadilha Adultrap

Foi utilizada a armadilha Adultrap em uma amostra de domicílio preconizada pelo levantamento de índice rápido de infestação por Aedes aegypti (LIRAa) para mensuração do número de adulto de Aedes aegypti no domicílio. Foi vistoriada uma média de 555 imóveis mês: 15 unidades continham criadouros da espécie; e 53, a presença de fêmeas. O índice de infestação para larva/pupa (IPL) variou de zero ao máximo de 4,9 por cento, enquanto o índice de infestação para adulto (IPA), de 2,21 a 17,32 por cento. O teste de MacNemar mostrou diferenças significativas entre a positividade de IPL e IPA em todos os meses do ano. Além disso, detectaram-se fêmeas de Ae. Aegypti em período de baixa densidade populacional, sem o caráter invasivo e incômodo da pesquisa de recipientes para o IPL. A Adultrap mostrou-se útil para revelar situações propícias à transmissão da dengue, bem como de fácil operacionalidade

DESCRIPTION OF THE IMMATURES OF WORKERS OF THE ANT CAMPONOTUS VITTATUS (HYMENOPTERA: FORMICIDAE)

Camponotus vittatus Forel is a poorly studied Neotropical ant, which is very common in Brazil. Larval descriptions are useful to systematics, as larval characters aid with genus-level differentiation, and ant larvae lie at the basis of ant social organization. This study presents the first description of the immatures of C. vittatus with the aid of light and scanning electron microscopy. There are three instars based on the frequency distribution of larval head widths. The larvae had some characteristics typical of Camponotus, specifically, a 'pogono-myrmecoid' body shape, 10 pairs of spiracles, antennae with 3 sensilla, mature larvae with pronounced labial pseudopalps, and conspicuous 'chiloscleres' on the labrum. Unique characteristics found would include the greatest diversity of body hair types recorded in an ant larva and 'camponotoid' mandibles with 6 medial denticles over the blade. The number of antennal sensilla proved variable.

The Liver Plays a Major Role in Clearance and Destruction of Blood Trypomastigotes in Trypanosoma cruzi Chronically Infected Mice

Intravenous challenge with Trypanosoma cruzi can be used to investigate the process and consequences of blood parasite clearance in experimental Chagas disease. One hour after intravenous challenge of chronically infected mice with 5610 6 trypomastigotes, the liver constituted a major site of parasite accumulation, as revealed by PCR. Intact parasites and/or parasite remnants were visualized at this time point scattered in the liver parenchyma. Moreover, at this time, many of liver-cleared parasites were viable, as estimated by the frequency of positive cultures, which considerably diminished after 48 h. Following clearance, the number of infiltrating cells in the hepatic tissue notably increased: initially (at 24 h) as diffuse infiltrates affecting the whole parenchyma, and at 48 h, in the form of large focal infiltrates in both the parenchyma and perivascular spaces. Phenotypic characterization of liver-infiltrating cells 24 h after challenge revealed an increase in Mac1(+), CD8(+) and CD4(+) cells, followed by natural killer (NK) cells. As evidence that liver-infiltrating CD4(+) and CD8(+) cells were activated, increased frequencies of CD69(+) CD8(+), CD69(+) CD4(+) and CD25(+) CD122(+) CD4(+) cells were observed at 24 and 48 h after challenge, and of CD25(-)CD122(+)CD4(+) cells at 48 h. The major role of CD4(+) cells in liver protection was suggested by data showing a very high frequency of interferon (IFN)-gamma-producing CD4(+) cells 24 h after challenge. In contrast, liver CD8(+) cells produced little IFN-gamma, even though they showed an enhanced potential for secreting this cytokine, as revealed by in vitro T cell receptor (TCR) stimulation. Confirming the effectiveness of the liver immune response in blood parasite control during the chronic phase of infection, no live parasites were detected in this organ 7 days after challenge.

Adenanthera pavonina TRYPSIN INHIBITOR RETARD GROWTH OF Anagasta kuehniella (LEPIDOPTERA: PYRALIDAE)

Anagasta kuehniella is a polyphagous pest that feeds on a wide variety of stored products. The possible roles suggested for seed proteinase inhibitors include the function as a part of the plant defensive system against pest via inhibition of their proteolytic enzymes. In this study, a trypsin inhibitor (ApTI) was purified from Adenanthera pavonina seed and was tested for insect growth regulatory effect. The chronic ingestion of ApTI did result in a significant reduction in larval survival and weight. Larval and pupal developmental time of larvae fed on ApTI diet at 1% was significantly longer; the larval period was extended by 5 days and pupal period was 10 days longer, therefore delaying by up to 20 days and resulting in a prolonged period of development from larva to adult. As a result, the ApTI diet emergence rate was only 28% while the emergence rate of control larvae was 80%. The percentage of surviving adults (%S) decreased to 62%. The fourth instar larvae reared on a diet containing 1% ApTI showed a decrease in tryptic activity of gut and that no novel proteolytic form resistant to ApTI was induced. In addition, the tryptic activity in ApTI -fed larvae was sensitive to ApTI. These results suggest that ApTI have a potential antimetabolic effect when ingested by A. kuehniella. (C) 2010 Wiley Periodicals, Inc.