990 resultados para Specific volume


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Current data indicate that the size of high-density lipoprotein (HDL) may be considered an important marker for cardiovascular disease risk. We established reference values of mean HDL size and volume in an asymptomatic representative Brazilian population sample (n=590) and their associations with metabolic parameters by gender. Size and volume were determined in HDL isolated from plasma by polyethyleneglycol precipitation of apoB-containing lipoproteins and measured using the dynamic light scattering (DLS) technique. Although the gender and age distributions agreed with other studies, the mean HDL size reference value was slightly lower than in some other populations. Both HDL size and volume were influenced by gender and varied according to age. HDL size was associated with age and HDL-C (total population); non- white ethnicity and CETP inversely (females); HDL-C and PLTP mass (males). On the other hand, HDL volume was determined only by HDL-C (total population and in both genders) and by PLTP mass (males). The reference values for mean HDL size and volume using the DLS technique were established in an asymptomatic and representative Brazilian population sample, as well as their related metabolic factors. HDL-C was a major determinant of HDL size and volume, which were differently modulated in females and in males.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Lateral pterygoid muscle (LPM) plays an important role in jaw movement and has been implicated in Temporomandibular disorders (TMDs). Migraine has been described as a common symptom in patients with TMDs and may be related to muscle hyperactivity. This study aimed to compare LPM volume in individuals with and without migraine, using segmentation of the LPM in magnetic resonance (MR) imaging of the TMJ. Twenty patients with migraine and 20 volunteers without migraine underwent a clinical examination of the TMJ, according to the Research Diagnostic Criteria for TMDs. MR imaging was performed and the LPM was segmented using the ITK-SNAP 1.4.1 software, which calculates the volume of each segmented structure in voxels per cubic millimeter. The chi-squared test and the Fisher's exact test were used to relate the TMD variables obtained from the MR images and clinical examinations to the presence of migraine. Logistic binary regression was used to determine the importance of each factor for predicting the presence of a migraine headache. Patients with TMDs and migraine tended to have hypertrophy of the LPM (58.7%). In addition, abnormal mandibular movements (61.2%) and disc displacement (70.0%) were found to be the most common signs in patients with TMDs and migraine. In patients with TMDs and simultaneous migraine, the LPM tends to be hypertrophic. LPM segmentation on MR imaging may be an alternative method to study this muscle in such patients because the hypertrophic LPM is not always palpable.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study was designed to evaluate the correlation between computed tomography findings and data from the physical examination and the Friedman Staging System (FSS) in patients with obstructive sleep apnea (OSA). We performed a retrospective evaluation by reviewing the medical records of 33 patients (19 male and 14 female patients) with a mean body mass index of 30.38 kg/m(2) and mean age of 49.35 years. Among these patients, 14 presented with severe OSA, 7 had moderate OSA, 7 had mild OSA, and 5 were healthy. The patients were divided into 2 groups according to the FSS: Group A comprised patients with FSS stage I or II, and group B comprised patients with FSS stage III. By use of the Fisher exact test, a positive relationship between the FSS stage and apnea-hypopnea index (P = .011) and between the FSS stage and body mass index (P = .012) was found. There was no correlation between age (P = .55) and gender (P = .53) with the FSS stage. The analysis of variance test comparing the upper airway volume between the 2 groups showed P = .018. In this sample the FSS and upper airway volume showed an inverse correlation and were useful in analyzing the mechanisms of airway collapse in patients with OSA.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Time Domain Reflectometry (TDR) is a reliable method for in-situ measurements of the humidity and the solution concentration at the same soil volume. Accurate interpretation of electrical conductivity (and soil humidity) measurements may require a specific calibration curve. The primary goal of this work was to establish a calibration procedure for using TDR to estimate potassium nitrate concentrations (KNO3) in soil solution. An equation relating the electrical conductivity measured by TDR and KNO3 concentration was established enabling the use of TDR technique to estimate soil water content and nitrate concentration for efficient fertigation management.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas . Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Universidade Estadual de Campinas. Faculdade de Educação Física

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geographic Data Warehouses (GDW) are one of the main technologies used in decision-making processes and spatial analysis, and the literature proposes several conceptual and logical data models for GDW. However, little effort has been focused on studying how spatial data redundancy affects SOLAP (Spatial On-Line Analytical Processing) query performance over GDW. In this paper, we investigate this issue. Firstly, we compare redundant and non-redundant GDW schemas and conclude that redundancy is related to high performance losses. We also analyze the issue of indexing, aiming at improving SOLAP query performance on a redundant GDW. Comparisons of the SB-index approach, the star-join aided by R-tree and the star-join aided by GiST indicate that the SB-index significantly improves the elapsed time in query processing from 25% up to 99% with regard to SOLAP queries defined over the spatial predicates of intersection, enclosure and containment and applied to roll-up and drill-down operations. We also investigate the impact of the increase in data volume on the performance. The increase did not impair the performance of the SB-index, which highly improved the elapsed time in query processing. Performance tests also show that the SB-index is far more compact than the star-join, requiring only a small fraction of at most 0.20% of the volume. Moreover, we propose a specific enhancement of the SB-index to deal with spatial data redundancy. This enhancement improved performance from 80 to 91% for redundant GDW schemas.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Purpose - The aim of this paper is to briefly present aspects of public brownfield management policies from Brazilian and German points of view. Design methodology approach - The data collection method combined literature and documental research. The bibliography included Brazilian and German literature about brownfield management. The documental research includes Brazilian and German legislation and official documents published by CETESB, the Environmental Company of the State of São Paulo, Brazil. Furthermore, publications of German governmental research institutions have been integrated in the paper. Findings - In Brazil, despite the lack of a federal public policy, the State of São Paulo has approved specific rules to deal with contaminated sites. Topics that could be targets of scientific studies have been identified. Experiences in Germany show that it is essential to have political will and cooperation between the different political levels and technical disciplines. Partnerships between German and Brazilian universities would be welcome as there is a wide range of opportunities for academic post-graduation studies and research focusing on human resources capacitation in environmental management. Originality value - The paper makes an original contribution of exploring an area (brownfield management) that is at the forefront of discussion in academe and industry