Characterization of the molecular components and function of BARE-1, Hin-Mu and Mu transposition machineries

Transposable elements, transposons, are discrete DNA segments that are able to move or copy themselves from one locus to another within or between their host genome(s) without a requirement for DNA homology. They are abundant residents in virtually all the genomes studied, for instance, the genomic portion of TEs is approximately 3% in Saccharomyces cerevisiae, 45% in humans, and apparently more than 70% in some plant genomes such as maize and barley. Transposons plays essential role in genome evolution, in lateral transfer of antibiotic resistance genes among bacteria and in life cycle of certain viruses such as HIV-1 and bacteriophage Mu. Despite the diversity of transposable elements they all use a fundamentally similar mechanism called transpositional DNA recombination (transposition) for the movement within and between the genomes of their host organisms. The DNA breakage and joining reactions that underlie their transposition are chemically similar in virtually all known transposition systems. The similarity of the reactions is also reflected in the structure and function of the catalyzing enzymes, transposases and integrases. The transposition reactions take place within the context of a transposition machinery, which can be particularly complex, as in the case of the VLP (virus like particle) machinery of retroelements, which in vivo contains RNA or cDNA and a number of element encoded structural and catalytic proteins. Yet, the minimal core machinery required for transposition comprises a multimer of transposase or integrase proteins and their binding sites at the element DNA ends only. Although the chemistry of DNA transposition is fairly well characterized, the components and function of the transposition machinery have been investigated in detail for only a small group of elements. This work focuses on the identification, characterization, and functional studies of the molecular components of the transposition machineries of BARE-1, Hin-Mu and Mu. For BARE-1 and Hin-Mu transpositional activity has not been shown previously, whereas bacteriophage Mu is a general model of transposition. For BARE-1, which is a retroelement of barley (Hordeum vulgare), the protein and DNA components of the functional VLP machinery were identified from cell extracts. In the case of Hin-Mu, which is a Mu-like prophage in Haemophilus influenzae Rd genome, the components of the core machinery (transposase and its binding sites) were characterized and their functionality was studied by using an in vitro methodology developed for Mu. The function of Mu core machinery was studied for its ability to use various DNA substrates: Hin-Mu end specific DNA substrates and Mu end specific hairpin substrates. The hairpin processing reaction by MuA was characterized in detail. New information was gained of all three machineries. The components or their activity required for functional BARE-1 VLP machinery and retrotransposon life cycle were present in vivo and VLP-like structures could be detected. The Hin-Mu core machinery components were identified and shown to be functional. The components of the Mu and Hin-Mu core machineries were partially interchangeable, reflecting both evolutionary conservation and flexibility within the core machineries. The Mu core machinery displayed surprising flexibility in substrate usage, as it was able to utilize Hin-Mu end specific DNA substrates and to process Mu end DNA hairpin substrates. This flexibility may be evolutionarily and mechanistically important.

Pentitol phosphate dehydrogenases: Discovery, characterization and use in D-arabitol and xylitol production by metabolically engineered Bacillus subtilis

The ultimate goal of this study has been to construct metabolically engineered microbial strains capable of fermenting glucose into pentitols D-arabitol and, especially, xylitol. The path that was chosen to achieve this goal required discovery, isolation and sequencing of at least two pentitol phosphate dehydrogenases of different specificity, followed by cloning and expression of their genes and characterization of recombinant arabitol and xylitol phosphate dehydrogenases. An enzyme of a previously unknown specificity, D-arabitol phosphate dehydrogenase (APDH), was discovered in Enterococcus avium. The enzyme was purified to homogenity from E. avium strain ATCC 33665. SDS/PAGE revealed that the enzyme has a molecular mass of 41 ± 2 kDa, whereas a molecular mass of 160 ± 5 kDa was observed under non-denaturing conditions implying that the APDH may exist as a tetramer with identical subunits. Purified APDH was found to have narrow substrate specificity, converting only D-arabitol 1-phosphate and D-arabitol 5-phosphate into D-xylulose 5-phosphate and D-ribulose 5-phosphate, respectively, in the oxidative reaction. Both NAD+ and NADP+ were accepted as co-factors. Based on the partial protein sequences, the gene encoding APDH was cloned. Homology comparisons place APDH within the medium chain dehydrogenase family. Unlike most members of this family, APDH requires Mn2+ but no Zn2+ for enzymatic activity. The DNA sequence surrounding the gene suggests that it belongs to an operon that also contains several components of phosphotransferase system (PTS). The apparent role of the enzyme is to participate in arabitol catabolism via the arabitol phosphate route similar to the ribitol and xylitol catabolic routes described previously. Xylitol phosphate dehydrogenase (XPDH) was isolated from Lactobacillus rhamnosus strain ATCC 15820. The enzyme was partially sequenced. Amino acid sequences were used to isolate the gene encoding the enzyme. The homology comparisons of the deduced amino acid sequence of L. rhamnosus XPDH revealed several similar enzymes in genomes of various species of Gram-positive bacteria. Two enzymes of Clostridium difficile and an enzyme of Bacillus halodurans were cloned and their substrate specificities together with the substrate specificity of L. rhamnosus XPDH were compared. It was found that one of the XPDH enzymes of C. difficile and the XPDH of L. rhamnosus had the highest selectivity towards D-xylulose 5-phosphate. A known transketolase-deficient and D-ribose-producing mutant of Bacillus subtilis (ATCC 31094) was further modified by disrupting its rpi (D-ribose phosphate isomerase) gene to create D-ribulose- and D-xylulose-producing strain. Expression of APDH of E. avium and XPDH of L. rhamnosus and C. difficile in D-ribulose- and D-xylulose-producing strain of B. subtilis resulted in strains capable of converting D-glucose into D-arabitol and xylitol, respectively. The D-arabitol yield on D-glucose was 38 % (w/w). Xylitol production was accompanied by co-production of ribitol limiting xylitol yield to 23 %.

Structure-Function Studies of GDNF Family Ligand-RET signalling

Glial cell line-derived neurotrophic factor (GDNF) and its family members neurturin (NRTN), artemin (ARTN) and persephin (PSPN) are growth factors, which are involved in the development, differentiation and maintenance of many neuron types. In addition, they function outside of the nervous system, e.g. in the development of kidney, testis and liver. GDNF family ligand (GFL) signalling happens through a tetrameric receptor complex, which includes two glycosylphosphatidylinositol (GPI)-anchored GDNF family receptor (GFRα) molecules and two RET (rearranged during transfection) receptor tyrosine kinases. Each of the ligands binds preferentially one of the four GFRα receptors: GDNF binds to GFRα1, NRTN to GFRα2, ARTN to GFRα3 and PSPN to GFRα4. The signal is then delivered by RET, which cannot bind the GFLs on its own, but can bind the GFL-GFRα complex. Under normal cellular conditions, RET is only phosphorylated on the cell surface after ligand binding. At least the GDNF-GFRα1 complex is believed to recruit RET to lipid rafts, where downstream signalling occurs. In general, GFRαs consist of three cysteine-rich domains, but all GFRα4s except for chicken GFRα4 lack domain 1 (D1). We characterised the biochemical and cell biological properties of mouse PSPN receptor GFRα4 and showed that it has a significantly weaker capacity than GFRα1 to recruit RET to the lipid rafts. In spite of that, it can phosphorylate RET in the presence of PSPN and contribute to neuronal differentiation and survival. Therefore, the recruitment of RET to the lipid rafts does not seem to be crucial for the biological activity of all GFRα receptors. Secondly, we demonstrated that GFRα1 D1 stabilises the GDNF-GFRα1 complex and thus affects the phosphorylation of RET and contributes to the biological activity. This may be important in physiological conditions, where the concentration of the ligand or the soluble GFRα1 receptor is low. Our results also suggest a role for D1 in heparin binding and, consequently, in the biodistribution of released GFRα1 or in the formation of the GFL-GFRα-RET complex. We also presented the crystallographic structure of GDNF in the complex with GFRα1 domains 2 and 3. The structure differs from the previously published ARTN-GFRα3 structure in three significant ways. The biochemical data verify the structure and reveal residues participating in the interactions between GFRα1 and GDNF, and preliminarily also between GFRα1 and RET and heparin. Finally, we showed that, the precursor of the oncogenic MEN 2B (multiple endocrine neoplasia type 2) form of RET gets phosphorylated already during its synthesis in the endoplasmic reticulum (ER). We also demonstrated that it associates with Src homology 2 domain-containing protein (SHC) and growth factor receptor-bound protein (GRB2) in the ER, and has the capacity to activate several downstream signalling molecules.

The Linker Region in Receptor Guanylyl Cyclases Is a Key Regulatory Module MUTATIONAL ANALYSIS OF GUANYLYL CYCLASE C

Receptor guanylyl cyclases are multidomain proteins, and ligand binding to the extracellular domain increases the levels of intracellular cGMP. The intracellular domain of these receptors is composed of a kinase homology domain (KHD), a linker of similar to 70 amino acids, followed by the C-terminal guanylyl cyclase domain. Mechanisms by which these receptors are allosterically regulated by ligand binding to the extracellular domain and ATP binding to the KHD are not completely understood. Here we examine the role of the linker region in receptor guanylyl cyclases by a series of point mutations in receptor guanylyl cyclase C. The linker region is predicted to adopt a coiled coil structure and aid in dimerization, but we find that the effects of mutations neither follow a pattern predicted for a coiled coil peptide nor abrogate dimerization. Importantly, this region is critical for repressing the guanylyl cyclase activity of the receptor in the absence of ligand and permitting ligand-mediated activation of the cyclase domain. Mutant receptors with high basal guanylyl cyclase activity show no further activation in the presence of non-ionic detergents, suggesting that hydrophobic interactions in the basal and inactive conformation of the guanylyl cyclase domain are disrupted by mutation. Equivalent mutations in the linker region of guanylyl cyclase A also elevated the basal activity and abolished ligand-and detergent-mediated activation. We, therefore, have defined a key regulatory role for the linker region of receptor guanylyl cyclases which serves as a transducer of information from the extracellular domain via the KHD to the catalytic domain.

Platelet endothelial cell adhesion molecule 1 (PECAM-1) and its interactions with glycosaminoglycans: 1. Molecular modeling studies

Platelet endothelial cell adhesion molecule 1 (PECAM-1) has many functions, including its roles in leukocyte extravasation as part of the inflammatory response and in the maintenance of vascular integrity through its contribution to endothelial cell−cell adhesion. PECAM-1 has been shown to mediate cell−cell adhesion through homophilic binding events that involve interactions between domain 1 of PECAM-1 molecules on adjacent cells. However, various heterophilic ligands of PECAM-1 have also been proposed. The possible interaction of PECAM-1 with glycosaminoglycans (GAGs) is the focus of this study. The three-dimensional structure of the extracellular immunoglobulin (Ig) domains of PECAM-1 were constructed using homology modeling and threading methods. Potential heparin/heparan sulfate-binding sites were predicted on the basis of their amino acid consensus sequences and a comparison with known structures of sulfate-binding proteins. Heparin and other GAG fragments have been docked to investigate the structural determinants of their protein-binding specificity and selectivity. The modeling has predicted two regions in PECAM-1 that appear to bind heparin oligosaccharides. A high-affinity binding site was located in Ig domains 2 and 3, and evidence for a low-affinity site in Ig domains 5 and 6 was obtained. These GAG-binding regions were distinct from regions involved in PECAM-1 homophilic interactions.

Computational analyses of the catalytic and heparin-binding sites and their interactions with glycosaminoglycans in glycoside hydrolase family 79 endo-d-glucuronidase (heparanase)

Mammalian heparanase is an endo-β-glucuronidase associated with cell invasion in cancer metastasis, angiogenesis and inflammation. Heparanase cleaves heparan sulfate proteoglycans in the extracellular matrix and basement membrane, releasing heparin/heparan sulfate oligosaccharides of appreciable size. This in turn causes the release of growth factors, which accelerate tumor growth and metastasis. Heparanase has two glycosaminoglycan-binding domains; however, no three-dimensional structure information is available for human heparanase that can provide insights into how the two domains interact to degrade heparin fragments. We have constructed a new homology model of heparanase that takes into account the most recent structural and bioinformatics data available. Heparin analogs and glycosaminoglycan mimetics were computationally docked into the active site with energetically stable ring conformations and their interaction energies were compared. The resulting docked structures were used to propose a model for substrates and conformer selectivity based on the dimensions of the active site. The docking of substrates and inhibitors indicates the existence of a large binding site extending at least two saccharide units beyond the cleavage site (toward the nonreducing end) and at least three saccharides toward the reducing end (toward heparin-binding site 2). The docking of substrates suggests that heparanase recognizes the N-sulfated and O-sulfated glucosamines at subsite +1 and glucuronic acid at the cleavage site, whereas in the absence of 6-O-sulfation in glucosamine, glucuronic acid is docked at subsite +2. These findings will help us to focus on the rational design of heparanase-inhibiting molecules for anticancer drug development by targeting the two heparin/heparan sulfate recognition domains.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

Mu in vitro transposition applications in protein engineering

Transposons, mobile genetic elements that are ubiquitous in all living organisms have been used as tools in molecular biology for decades. They have the ability to move into discrete DNA locations with no apparent homology to the target site. The utility of transposons as molecular tools is based on their ability to integrate into various DNA sequences efficiently, producing extensive mutant clone libraries that can be used in various molecular biology applications. Bacteriophage Mu is one of the most useful transposons due to its well-characterized and simple in vitro transposition reaction. This study establishes the properties of the Mu in vitro transposition system as a versatile multipurpose tool in molecular biology. In addition, this study describes Mu-based applications for engineering proteins by random insertional transposon mutagenesis in order to study structure-function relationships in proteins. We initially characterized the properties of the minimal Mu in vitro transposition system. We showed that the Mu transposition system works efficiently and accurately and produces insertions into a wide spectrum of target sites in different DNA molecules. Then, we developed a pentapeptide insertion mutagenesis strategy for inserting random five amino acid cassettes into proteins. These protein variants can be used especially for screening important sites for protein-protein interactions. Also, the system may produce temperature-sensitive variants of the protein of interest. Furthermore, we developed an efficient screening system for high-resolution mapping of protein-protein interfaces with the pentapeptide insertion mutagenesis. This was accomplished by combining the mutagenesis with subsequent yeast two-hybrid screening and PCR-based genetic footprinting. This combination allows the analysis of the whole mutant library en masse, without the need for producing or isolating separate mutant clones, and the protein-protein interfaces can be determined at amino acid accuracy. The system was validated by analysing the interacting region of JFC1 with Rab8A, and we show that the interaction is mediated via the JFC1 Slp homology domain. In addition, we developed a procedure for the production of nested sets of N- and C-terminal deletion variants of proteins with the Mu system. These variants are useful in many functional studies of proteins, especially in mapping regions involved in protein-protein interactions. This methodology was validated by analysing the region in yeast Mso1 involved in an interaction with Sec1. The results of this study show that the Mu in vitro transposition system is versatile for various applicational purposes and can efficiently be adapted to random protein engineering applications for functional studies of proteins.

Molecular modeling of Bt Cry1Ac (DI–DII)–ASAL (Allium sativum lectin)–fusion protein and its interaction with aminopeptidase N (APN) receptor of Manduca sexta

Genetic engineering of Bacillus thuringiensis (Bt) Cry proteins has resulted in the synthesis of various novel toxin proteins with enhanced insecticidal activity and specificity towards different insect pests. In this study, a fusion protein consisting of the DI–DII domains of Cry1Ac and garlic lectin (ASAL) has been designed in silico by replacing the DIII domain of Cry1Ac with ASAL. The binding interface between the DI–DII domains of Cry1Ac and lectin has been identified using protein–protein docking studies. Free energy of binding calculations and interaction profiles between the Cry1Ac and lectin domains confirmed the stability of fusion protein. A total of 18 hydrogen bonds was observed in the DI–DII–lectin fusion protein compared to 11 hydrogen bonds in the Cry1Ac (DI–DII–DIII) protein. Molecular mechanics/Poisson–Boltzmann (generalized-Born) surface area [MM/PB (GB) SA] methods were used for predicting free energy of interactions of the fusion proteins. Protein–protein docking studies based on the number of hydrogen bonds, hydrophobic interactions, aromatic–aromatic, aromatic–sulphur, cation–pi interactions and binding energy of Cry1Ac/fusion proteins with the aminopeptidase N (APN) of Manduca sexta rationalised the higher binding affinity of the fusion protein with the APN receptor compared to that of the Cry1Ac–APN complex, as predicted by ZDOCK, Rosetta and ClusPro analysis. The molecular binding interface between the fusion protein and the APN receptor is well packed, analogously to that of the Cry1Ac–APN complex. These findings offer scope for the design and development of customized fusion molecules for improved pest management in crop plants.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Genetic studies of the PRP17 gene of Saccharomyces cerevisiae: a domain essential for function maps to a nonconserved region of the protein

The PRP17 gene product is required for the second step of pre-mRNA splicing reactions. The C-terminal half of this protein bears four repeat units with homology to the beta transducin repeat. Missense mutations in three temperature-sensitive prp17 mutants map to a region in the N-terminal half of the protein. We have generated, in vitro, 11 missense alleles at the beta transducin repeat units and find that only one affects function in vivo. A phenotypically silent missense allele at the fourth repeat unit enhances the slow-growing phenotype conferred by an allele at the third repeat, suggesting an interaction between these domains. Although many missense mutations in highly conserved amino acids lack phenotypic effects, deletion analysis suggests an essential role for these units. Only mutations in the N-terminal nonconserved domain of PRP17 are synthetically lethal in combination with mutations in PRP16 and PRP18, two other gene products required for the second splicing reaction. A mutually allele-specific interaction between Prp17 and snr7, with mutations in U5 snRNA, was observed. We therefore suggest that the functional region of Prp17p that interacts with Prp18p, Prp16p, and U5 snRNA is the N terminal region of the protein.

Structural basis of cytoskeletal regulation by twinfilin

The actin cytoskeleton is required, in all eukaryotic organisms, for several key cellular functions such as cell motility, cytokinesis, and endocytosis. In cells, actin exists either in a monomeric state (G-actin) or in a filamentous form (F-actin). F-actin is the functional form, which can assemble into various structures and produce direct pushing forces that are required for different motile processes. The assembly of actin monomers into complicated three-dimensional structures is tightly regulated by a large number of actin regulating proteins. One central actin regulating protein is twinfilin. Twinfilin consists of two actin depolymerizing-factor homology (ADF-H) domains, which are capable of binding actin, and is conserved from yeast to mammals. Previously it has been shown that twinfilin binds to and sequesters G-actin, and interacts with the heterodimeric capping protein. More recently it has been found that twinfilin also binds to the fast growing actin filament ends and prevents their growth. However, the cellular role of twinfilin and the molecular mechanisms of these interactions have remained unclear. In this study we characterized the molecular mechanisms behind the functions of twinfilin. We demonstrated that twinfilin forms a high-affinity complex with ADP-bound actin monomers (ADP-G-actin). Both ADF-H domains are capable of binding G-actin, but the C-terminal domain contains the high-affinity binding site. Our biochemical analyses identified twinfilin s C-terminal tail region as the interaction site for capping protein. Contrary to G-actin binding, both ADF-H domains of twinfilin are required for the actin filament barbed end capping activity. The C-terminal domain is structurally homologous to ADF/cofilin and binds to filament sides in a similar manner, providing the main affinity for F-actin during barbed end capping. The structure of the N-terminal domain is more distant from ADF/cofilin, and thus it can only associate with G-actin or the terminal actin monomer at the filament barbed end, where it regulates twinfilin s affinity for barbed ends. These data suggest that the mechanism of barbed end capping is similar for twinfilin and gelsolin family proteins. Taken together, these studies revealed how twinfilin interacts with G-actin, filament barbed ends, and capping protein, and also provide a model for how these activities evolved through a duplication of an ancient ADF/cofilin-like domain.

Identification of the fungal catabolic D-galacturonate pathway

Pectin is a natural polymer consisting mainly of D-galacturonic acid monomers. Microorganisms living on decaying plant material can use D-galacturonic acid for growth. Although bacterial pathways for D-galacturonate catabolism had been described previously, no eukaryotic pathway for D-galacturonate catabolism was known at the beginning of this work. The aim of this work was to identify such a pathway. In this thesis the pathway for D-galacturonate catabolism was identified in the filamentous fungus Trichoderma reesei. The pathway consisted of four enzymes: NADPH-dependent D-galacturonate reductase (GAR1), L-galactonate dehydratase (LGD1), L-threo-3-deoxy-hexulosonate aldolase (LGA1) and NADPH-dependent glyceraldehyde reductase (GLD1). In this pathway D-galacturonate was converted to pyruvate and glycerol via L-galactonate, L-threo-3-deoxy-hexulosonate and L-glyceraldehyde. The enzyme activities of GAR1, LGD1 and LGA1 were present in crude mycelial extract only when T. reesei was grown on D-galacturonate. The activity of GLD1 was equally present on all the tested carbon sources. The corresponding genes were identified either by purifying and sequencing the enzyme or by expressing genes with homology to other similar enzymes in a heterologous host and testing the activities. The new genes that were identified were expressed in Saccharomyces cerevisiae and resulted in active enzymes. The GAR1, LGA1 and GLD1 were also produced in S. cerevisiae as active enzymes with a polyhistidine-tag, and purified and characterised. GAR1 and LGA1 catalysed reversible reactions, whereas only the forward reactions were observed for LGD1 and GLD1. When gar1, lgd1 or lga1 was deleted in T. reesei the deletion strain was unable to grow with D-galacturonate as the only carbon source, demonstrating that all the corresponding enzymes were essential for D-galacturonate catabolism and that no alternative D-galacturonate pathway exists in T. reesei. A challenge for biotechnology is to convert cheap raw materials to useful and more valuable products. Filamentous fungi are especially useful for the conversion of pectin, since they are efficient producers of pectinases. Identification of the fungal D-galacturonate pathway is of fundamental importance for the utilisation of pectin and its conversion to useful products.

Structure-Based Design of DevR Inhibitor Active against Nonreplicating Mycobacterium tuberculosis

Antitubercular treatment is directed against actively replicating organisms. There is an urgent need to develop drugs targeting persistent subpopulations of Mycobacterium tuberculosis. The DevR response regulator is believed to play a key role in bacterial dormancy adaptation during hypoxia. We developed a homology-based model of DevR and used it for the rational design of inhibitors. A phenylcoumarin derivative (compound 10) identified by in silico pharmacophore-based screening of 2.5 million compounds employing protocols with some novel features including a water-based pharmacophore query, was characterized further. Compound 10 inhibited DevR binding to target DNA, down-regulated dormancy genes transcription, and drastically reduced survival of hypoxic but not nutrient-starved dormant bacteria or actively growing organ ` isms. Our findings suggest that compound 10 ``locks'' DevR in an inactive conformation that is unable to bind cognate DNA and induce the dormancy regulon. These results provide proof-of-concept for DevR as a novel target to develop molecules with sterilizing activity against tubercle bacilli.

Prediction of protein-protein interactions between Helicobacter pylori and a human host

A lack of information on protein-protein interactions at the host-pathogen interface is impeding the understanding of the pathogenesis process. A recently developed, homology search-based method to predict protein-protein interactions is applied to the gastric pathogen, Helicobacter pylori to predict the interactions between proteins of H. pylori and human proteins in vitro. Many of the predicted interactions could potentially occur between the pathogen and its human host during pathogenesis as we focused mainly on the H. pylori proteins that have a transmembrane region or are encoded in the pathogenic island and those which are known to be secreted into the human host. By applying the homology search approach to protein-protein interaction databases DIP and iPfam, we could predict in vitro interactions for a total of 623 H. pylori proteins with 6559 human proteins. The predicted interactions include 549 hypothetical proteins of as yet unknown function encoded in the H. pylori genome and 13 experimentally verified secreted proteins. We have recognized 833 interactions involving the extracellular domains of transmembrane proteins of H. pylori. Structural analysis of some of the examples reveals that the interaction predicted by us is consistent with the structural compatibility of binding partners. Examples of interactions with discernible biological relevance are discussed.