1000 resultados para fruit plants


Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this research was to investigate the antiproliferative and anticholinesterase activities of 11 extracts from 5 Annonaceae species in vitro. Antiproliferative activity was assessed using 10 human cancer cell lines. Thin-layer chromatography and a microplate assay were used to screen the extracts for acetylcholinesterase (AchE) inhibitors using Ellman's reagent. The chemical compositions of the active extracts were investigated using high performance liquid chromatography. Eleven extracts obtained from five Annonaceae plant species were active and were particularly effective against the UA251, NCI-470 lung, HT-29, NCI/ADR, and K-562 cell lines with growth inhibition (GI50) values of 0.04-0.06, 0.02-0.50, 0.01-0.12, 0.10-0.27, and 0.02-0.04 µg/mL, respectively. In addition, the Annona crassiflora and A. coriacea seed extracts were the most active among the tested extracts and the most effective against the tumor cell lines, with GI50 values below 8.90 µg/mL. The A. cacans extract displayed the lowest activity. Based on the microplate assay, the percent AchE inhibition of the extracts ranged from 12 to 52%, and the A. coriacea seed extract resulted in the greatest inhibition (52%). Caffeic acid, sinapic acid, and rutin were present at higher concentrations in the A. crassiflora seed samples. The A. coriacea seeds contained ferulic and sinapic acid. Overall, the results indicated that A. crassiflora and A. coriacea extracts have antiproliferative and anticholinesterase properties, which opens up new possibilities for alternative pharmacotherapy drugs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pectic substances are structural heteropolysaccharides that occur in the middle lamellae and primary cell walls of higher plants. They are composed of partially methyl-esterified galacturonic acid residues linked by alpha-1, 4-glycosidic bonds. Pectinolytic enzymes are complex enzymes that degrade pectic polymers and there are several classes of enzymes, which include pectin esterases, pectin and pectate lyases and polygalacturonases. Plants, filamentous fungi, bacteria and yeasts are able to produce pectinases. In the industrial world, pectinases are used in fruit juice clarification, in the production of wine, in the extraction of olive oil, fiber degumming and fermentation of tea, coffee and cocoa.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We studied the feeding behavior of bats and their role in the seed dispersal of Vismia cayennensis in Manaus region, Amazonas State, northern Brazil. The characteristics of the plant and its fruits fit the chiropterocory syndrome. Five species of phyllostomid bats fed on Vismia fruits: Sturnira lilium, Sturnira tildae, Artibeus concolor, Carollia perspicillata and Rhinophylla pumilio. Apparently there is a relationship between flock foraging behavior and fruit availability in early night. The feeding behavior was similar for all bat species, varying with the presentation mode of the fruits. Seed germination tests and the distributional patterns of the plants indicate that bats are the dispersers of V. cayennensis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Annona dioica St. Hil. is a species that grows to approximately 2 m tall and is very widespread in the cerrados. Individual plants of this androdioecious species produce numerous hermaphroditic or male flowers, but few fruits. The aim of this study was to determine the sex ratio among the plants and to compare the frequency of herbivory between male and hermaphroditic flowers. The fieldwork was done by studying flowering plants in grasslands used as pasture for cattle at Fazenda Nhumirim. One hundred and forty-seven male plants and 71 hermaphroditic plants were examined and produced a total of 194 and 94 flowers, respectively, during the study period. The male:hermaphrodite sex ratio was 2.07:1, and was similar to the male:hermaphrodite flower ratio of 2.06:1. The frequency of florivory rate in hermaphrodites was significantly higher than in male flowers (33.0%, n = 31, and 25.7%, n = 50, respectively; G = 14.83; d.f. = 1; p < 0.001). The mean fresh weights of male and hermaphroditic flowers were significantly different (8.38 ± 2.40 g vs. 6.93 ± 2.68 g, respectively; 0 ± SEM; n = 50 each; t = 2.479; d.f. = 49; p = 0.017). These results indicate that the low fruit set in this species can be explained by the sex ratio, the greater herbivory of hermaphroditic flowers and the probable absence of pollinators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Low temperatures negatively impact the metabolism of orange trees, and the extent of damage can be influenced by the rootstock. We evaluated the effects of low nocturnal temperatures on Valencia orange scions grafted on Rangpur lime or Swingle citrumelo rootstocks. We exposed six-month-old plants to night temperatures of 20ºC and 8ºC under controlled conditions. After decreasing the temperature to 8ºC, there were decreases in leaf CO2 assimilation, stomatal conductance, mesophyll conductance and CO2 concentration in the chloroplasts, in plant hydraulic conductivity and in the maximum electron transport rate driven ribulose-1,5-bisphosphate (RuBP) regeneration in plants grafted on both rootstocks. However, the effects of low night temperature were more severe in plants grafted on Rangpur rootstock, which also presented reduction in the maximum rate of RuBP carboxylation and in the maximum quantum efficiency of the PSII. In general, irreversible damage due to night chilling was found in the photosynthetic apparatus of plants grafted on Rangpur lime. Low night temperatures induced similar changes in the antioxidant metabolism, preventing oxidative damage in citrus leaves on both rootstocks. As photosynthesis is linked to plant growth, our findings indicate that the rootstock may improve the performance of citrus trees in environments with low night temperatures, with Swingle rootstock improving the photosynthetic acclimation in leaves of orange plants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nowadays the composting process has shown itself to be an alternative in the treatment of municipal solid wastes by composting plants. However, although more than 50% of the waste generated by the Brazilian population is composed of matter susceptible to organic composting, this process is, still today, insufficiently developed in Brazil, due to low compost quality and lack of investments in the sector. The objective of this work was to use physical analyses to evaluate the quality of the compost produced at 14 operative composting plants in the Sao Paulo State in Brazil. For this purpose, size distribution and total inert content tests were done. The results were analyzed by grouping the plants according to their productive processes: plants with a rotating drum, plants with shredders or mills, and plants without treatment after the sorting conveyor belt. Compost quality was analyzed considering the limits imposed by the Brazilian Legislation and the European standards for inert contents. The size distribution tests showed the influence of the machinery after the sorting conveyer on the granule sizes as well as the inert content, which contributes to the presence of materials that reduce the quality of the final product

Relevância:

20.00% 20.00%

Publicador:

Resumo:

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.