Análise do comportamento reológico de pastas de cimento contendo resíduos de pneu para poços de petróleo

The low tenacity presented by the Portland cement pastes used in the oil wells cementation has been motivating several researches with attention focused on alternative materials. Additives have been developed to generate flexible pastes with mechanical resistance capable to support the expansions and retractions of the metallic covering of the wells that submit to the steam injection, technique very used to increase the recovery factor in oil reservoirs with high viscosity. A fresh paste with inadequate rheological behavior may commit the cementation process seriously, involving flaws that affect the performance of the paste substantially in the hardened state. This work proposes the elaboration and the rheological analysis of Portland cement pastes with addition of residues of rubber tire in several proportions, with the aim of minimizing the damages provoked in the hem cementing of these wells. By thermogravimetric analysis, the particles of eraser that go by the sieve of 0,5mm (35 mesh) opening and treated superficially with NaOH solution of 1 mol/L presented appropriate thermal resistance for wells that submit to thermal cyclic. The evaluation of the study based on the results of the rheological analysis of the pastes, complemented by the mechanical analysis, thickening, stability, tenor of free water and filtrate loss, being used as parameter a paste reference, without rubber addition. The results showed satisfactory rheology, passive of few corrections; considerable loss of mechanical resistance (traction and compression), compensated by earnings of tenacity, however with established limits for its application in oil wells; satisfactory stability, free water and thickening time

Diagnóstico das espécies ativas do plasma usado em tratamentos termoquímicos do titânio

Plasma diagnostics by Optical Emission Spectroscopy were performed for electrical discharge in three gas mixture respecting the combinations z N2 y Ar x H2, z N2 y Ar x O2 e z N2 y Ar x CH4, in which the indexes z and y systematically vary from 1 to 4 and x varies from 0 to 4, every one has dimension SCCM, resulting in 80 combinations. From the all obtained spectrums, the species CH (387,1 nm), N2+ (391,4 nm), Hβ (486,1 nm), Hα (656,3 nm), Ar (750,4 nm), O (777,4 nm) e O (842,6 nm) were analyzed because of their abundance and importance on the kinetic of reaction from the plasma to surface, besides their high dependences on the gases flows. Particularly interesting z, y and x combinations were chosen in order to study the influence of active species on the surface modification during the thermochemical treatment. From the mixtures N2 Ar O2 e N2 Ar CH4 were chosen three peculiar proportions which presented luminous intensity profile with unexpected maximum or minimum values, denominated as plasma anomaly. Those plasma concentrations were utilized as atmosphere of titanium treatment maintaining constant the control parameters pressure and temperature. It has been verified a relation among luminous intensity associated to N2+ and roughness, nanohardness and O atoms diffusion into the crystalline lattice of treated titanium and it has been seen which those properties becomes more intense precisely in the higher points found in the optical profile associated to the N2+ specie. Those parameters were verified for the mixture which involved O2 gas. For the mixture which involves CH4 gas, the relation was determinate by roughness, number of nitrogen and carbon atoms diffused into the titanium structure which presented direct proportionality with the luminous intensity referent to the N2+ and CH. It has been yet studied the formation of TiCN phases on the surface which presented to be essentially directly proportional to the increasing of the CH specie and inversely proportional to the increasing of the specie N2+

Avaliação do efeito da adição de resíduo de borracha de pneu e brita calcária na formulação de compósitos cimentíceos

Researches have shown that the introduction of rubber in concrete improves the features of its deformability, as well as contributes to environmental disposal of waste generated in the tire retreading process. Furthermore, there is a high availability of limestone within RN and CE country. Ignorance about this stone, does not allow its wide use as aggregate, leaving, this abundant supply idle. A composite of limestone gravel, with proportions of tire rubber waste which could be used as concrete would be an alternative to concrete for low applications. Therefore, this research aims to evaluate the characteristics of concrete containing limestone gravel and proportions of little aggregate replacement (sand) by tire rubber waste. To this goal, the material components of the concrete were characterized, concrete specimens with limestone gravel were made, from the dash 1.0: 2.5: 3.5, varying the water/cement ratio, and inserting a commercial plasticizer, without a proportion of residue, known as reference. From this, concrete with and without the presence of the additive in the same proportions were chosen, as well as these with the use of granite gravel, for being the most used. Selected the references, to these, replacements of little aggregate (sand) were added replaced by rubber waste from the tire retreading process, treated with 1M NaOH in proportions from 5.0 to 20.0 % by mass, cured and exposed to the semiarid environment. The results indicate the possibility of using limestone gravel in the concrete composition with workability correction using plasticizer. There was a decrease in the mechanical properties of the concrete with increments of waste rubber, but there is an improvement in toughness and deformability of the composite, which makes it interesting for the construction of non-structural concrete floors, as well as, the rubber waste delayed the hardening process, continuing to gain resistance after 28 days

TERRITÓRIO USADO E PACTO FEDERATIVO NO BRASIL: UM ESTUDO DA DISTRIBUIÇÃO INTERGOVERNAMENTAL DE RECURSOS TRIBUTÁRIOS

Este trabalho busca apresentar uma discussão acerca da constituição do território brasileiro a partir de sua estrutura estatal federativa e organização política. Para tanto, a idéia de território usado (SANTOS, 1994, 1996; SANTOS; SILVEIRA, 2001) se apresenta como instrumento analítico de suma relevância. Conforme Santos e Silveira (2001, p. 20) o “que interessa discutir é, então, o território usado, sinônimo de espaço geográfico. Essa categoria, território usado, aponta para necessidade de um esforço destinado a analisar sistematicamente a constituição do território. Como se trata de uma proposta totalmente empiricizável, segue-se daí o enriquecimento da teoria”. Entender o território usado implica entender que existe um conjunto de ações – ou seja, um evento – que dinamizam este território e que, quando dinamizado, este mesmo território retorna como um condicionante das ações sociais. Seguindo pelo mesmo partido de método proposto por Santos (1996), entendemos aqui território usado como conjunto indissociável de sistema de objetos (materialidades) e de sistemas de ações (eventos). A federação no Brasil pode ser tratada, teoricamente, como um evento, isto é, a instituição da federação foi um conjunto de acontecimentos que atingiram e transformaram o território e, a partir desse momento esse mesmo território se tornou uma norma para a vigência dessa federação. No país, os mecanismos de distribuição e de redistribuição de recursos entre os entes federados adquirem grande importância pelo fato de serem eles os elementos que permitem uma maior ou menor autonomia na administração pública. Parcelas do território recebem mais recursos do que outras proporcionando, assim, uma difusão seletiva do meio técnico-científico-informacional (SANTOS, 1996) pelo território.

Interictal hyposexuality in male patients with epilepsy

The purpose of this study was to compare the serum levels of androgens between hyposexual and non-hyposexual patients with epilepsy. Adult male patients with epilepsy were investigated. Serum levels of testosterone (T) and free-T, estradiol, and sex hormone binding globulin (SHBG) were measured and the free androgen index (FAI) was calculated. While there were no differences between hyposexual and non-hyposexual patients in the serum levels of T, free-T, and estradiol, or to the FAI, the serum levels of SHBG were significantly higher in hyposexual patients than in non-hyposexual patients. Thus, the effects of increased SHBG upon serum levels of testosterone biologically active in patients with epilepsy and hyposexuality were not detected by the methods used in this study. Four (44%) of nine hyposexual patients who were re-evaluated after two years follow-up improved sexual performance. Thus, clinical treatment that results in good seizure control may improve sexual performance in some patients with epilepsy.

A COMPETÊNCIA LEXICAL DE ALUNOS UNIVERSITÁRIOS APRENDENDO A LER EM INGLÊS COMO LÍNGUA ESTRANGEIRA

This article presents a characterization of the lexical competence (vocabulary knowledge and use) of students learning to read in EFL in a public university in São Paulo state. Although vocabulary has been consistently cited as one of the EFL reader´s main source of difficulty, there is no data in the literature which shows the extent of the difficulties. The data for this study is part of a previous research, which investigates, from the perspective of an interactive model of reading, the relationship between lexical competence and EFL reading comprehension. Quantitative as well as qualitative data was considered. For this study, the quantitative data is the product of vocabulary tests of 49 subjects while the qualitative data comprises pause protocols of three subjects, with levels of reading ability ranging from good to poor, selected upon their performance in the quantitative study. A rich concept of vocabulary knowledge was adapted and used for the development of vocabulary tests and analysis of protocols. The results on both studies show, with a few exceptions, the lexical competence of the group to be vague and imprecise in two dimensions: quantitative (number of known words or vocabulary size) and qualitative (depth or width of this knowledge). Implications for the teaching of reading in a foreign context are discussed.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The use of fluorescence in situ hybridization in the diagnosis of hidden mosaicism: apropos of three cases of sex chromosome anomalies

FISH has been used as a complement to classical cytogenetics in the detection of mosaicism in sex chromosome anomalies. The aim of this study is to describe three cases in which the final diagnosis could only be achieved by FISH. Case 1 was an 8-year-old 46,XY girl with normal female genitalia referred to our service because of short stature. FISH analysis of lymphocytes with probes for the X and Y centromeres identified a 45,X/46,X,idic(Y) constitution, and established the diagnosis of Turner syndrome. Case 2 was a 21-month-old 46,XY boy with genital ambiguity (penile hypospadias, right testis, and left streak gonad). FISH analysis of lymphocytes and buccal smear identified a 45,X/46,XY karyotype, leading to diagnosis of mixed gonadal dysgenesis. Case 3 was a 47,XYY 19-year-old boy with delayed neuromotor development, learning disabilities, psychological problems, tall stature, small testes, elevated gonadotropins, and azoospermia. FISH analysis of lymphocytes and buccal smear identified a 47,XYY/48,XXYY constitution. Cases 1 and 2 illustrate the phenotypic variability of the 45,X/46,XY mosaicism, and the importance of detection of the 45,X cell line for proper management and follow-up. In case 3, abnormal gonadal function could be explained by the 48,XXYY cell line. The use of FISH in clinical practice is particularly relevant when classical cytogenetic analysis yields normal or uncertain results in patients with features of sex chromosome aneuploidy. Arq Bras Endocrinol Metab. 2012;56(8):545-51

Imigrantes bolivianos em São Paulo : a Praça Kantuta e o futebol

Universidade Estadual de Campinas . Faculdade de Educação Física

Metodologia para analise cinematica de volumes respiratorios parciais de nadadores

Universidade Estadual de Campinas . Faculdade de Educação Física

Pedagogia de esporte : aspectos motriz de aprendizagem em hoquei em patins, crianças de oito a dez anos

Universidade Estadual de Campinas. Faculdade de Educação Física

Avaliações autonômicas e cardiovasculares em pessoas com lesão da medula espinhal nas situações de repouso, em um teste de estresse mental e durante exercício físico

Universidade Estadual de Campinas . Faculdade de Educação Física

Calibração de câmeras para análises subaquáticas de movimentos = : Cameras calibration for underwater motion analysis

Universidade Estadual de Campinas . Faculdade de Educação Física

Efeito residual no triathlon : como nadar influência nas etapas seguintes

Universidade Estadual de Campinas. Faculdade de Educação Física