Utilização de 1-metilciclopropeno e resfriamento rápido na conservação de pêssegos

Postharvest losses vary among the different vegetable products. However, among fruits and vegetables the losses generally range from 30% to 50%. Thus, this paper aimed the application of 1-methylcycloprene (1-MCP) and fast cooling with forced air (PC) on peaches, in order to estimate their effects in the ripening process of this fruit. Physiological analyses were performed, such as loss of fresh mass, firmness, pH, titratable acidity, soluble solids, ratio and CO2 production, as well as sensorial analyses such as color, texture and flavor. The experiment was divided in two phases. In the first one, concentrations of 30, 60, and 90 nL/L 1-MCP, applied at 0 ºC and 20 ºC, were tested. The fruits treated without 1-MCP were denominated control for both temperatures studied. The second phase was composed by the following treatments: cold storage (CS) or control, cooling with forced air (CFA), cooling with forced air followed by 1-MCP application (CFA + 1-MCP) and 1-MCP application (1-MCP). Among these, the CFA + 1-MCP treatment provided more firmness of the fruits in comparison to the control fruits. The respiratory rate of peaches under CFA and CFA + 1-MCP treatments decreased in comparison to the control fruit respiratory rates.

Caracterização de dois equipamentos de beneficiamento e classificação de tomates para mesa

On the last years, in Brazil, sorting and classifying fruits and vegetables using packing lines have increased. This work aimed at characterizing the cleaning process for fresh market tomatoes at two packing lines, one imported and one national located at Campinas, São Paulo State. Characterization included data, number, types and brushes velocity, water use, fruit standing time and cleaning efficiency. Standing time was measured correlating to fruit diameter (CEAGESP). For measuring cleaning efficiency an equipment was developed that was mainly composed of a ring involved with white cloth. Samples were taken before and after the cleaning step and evaluated using a colorimeter HUNTER Lab. The results showed a strong difference between the two equipments. The imported equipment showed lower number on brushes and rotation than national one, however a higher water consumption. For imported equipments this relation was not found. Both packing lines showed the same cleaning efficiency. Cleaning efficiency is related to be an interaction among the studies parameters, and it could be necessary a better management than the one used on both equipments.

Otimização da eficiência de limpeza em equipamento de beneficiamento de tomate de mesa

The post-harvesting cleaning process in fresh market tomatoes production is essential to the consumer acceptance, since the degree of dirtiness of the fruits is directly related to its quality. However, the washing stage of the cleaning process of commercial packinghouse demands an excessive water volume, bringing serious environmental concerns. The objective of this work was to compare the cleaning efficiency in two cleaning systems through the evaluation of different operational conditions of the cleaning process, related with the brush rotation, water flow and fruit standing time under the system. It was compared the conventional system utilized in commercial equipment with a system using commercial sprays. The results showed that the cleaning efficiency was not directly related to the water volume used, but to the water pressure, standing time and brushes rotation. Therefore, the use of commercial sprays can bring benefits to the cleaning efficiency, increasing it up to 13%, and to the environmental, decreasing water consumption.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Taxonomic value of foliar characters in Dahlstedtia Malme: Leguminosae, Papilionoideae, Millettieae

Dahlstedtia Malme (Leguminosae) is a neotropical genus, native to the Brazilian Atlantic Forest, and comprises two species, D. pinnata (Benth.) Malme and D. pentaphylla (Taub.) Burk., although it has been considered a monotypic genus by some authors. Leaf anatomy was compared to verify the presence of anatomical characters to help delimit species. Foliar primordium, leaflet, petiolule, petiole and pulvinus were collected from cultivated plants (Campinas, SP, Brazil) and from natural populations (Picinguaba, Ubatuba and Caraguatatuba, SP, Brazil - D. pinnata; Antonina, PR, Brazil - D. pentaphylla). Studies on leaflet surface assessment (Scanning Electron Microscopy), as well as histology and venation analyses were carried out of dehydrated, fresh and fixed material from two species. Leaflet material was macerated for stomatal counts. Histological sections, obtained by free-hand cut or microtome, were stained with Toluidine Blue, Safranin/Alcian Blue, Ferric Chloride, Acid Phloroglucin. Secretory cavities are present in the lamina, petiolule, petiole, pulvinus and leaf primordium in D. pentaphylla, but not in D. pinnata, and can be considered an important character for species diagnosis. Other leaf characters were uninformative in delimiting Dahlstedtia species. There is cambial activity in the petiolule, petiole and pulvinus. This study, associated with other available data, supports the recognition of two species in Dahlstedtia.

Florivory and sex ratio in Annona dioica St. Hil. (Annonaceae) in the Pantanal at Nhecolândia, southwestern Brazil

Annona dioica St. Hil. is a species that grows to approximately 2 m tall and is very widespread in the cerrados. Individual plants of this androdioecious species produce numerous hermaphroditic or male flowers, but few fruits. The aim of this study was to determine the sex ratio among the plants and to compare the frequency of herbivory between male and hermaphroditic flowers. The fieldwork was done by studying flowering plants in grasslands used as pasture for cattle at Fazenda Nhumirim. One hundred and forty-seven male plants and 71 hermaphroditic plants were examined and produced a total of 194 and 94 flowers, respectively, during the study period. The male:hermaphrodite sex ratio was 2.07:1, and was similar to the male:hermaphrodite flower ratio of 2.06:1. The frequency of florivory rate in hermaphrodites was significantly higher than in male flowers (33.0%, n = 31, and 25.7%, n = 50, respectively; G = 14.83; d.f. = 1; p < 0.001). The mean fresh weights of male and hermaphroditic flowers were significantly different (8.38 ± 2.40 g vs. 6.93 ± 2.68 g, respectively; 0 ± SEM; n = 50 each; t = 2.479; d.f. = 49; p = 0.017). These results indicate that the low fruit set in this species can be explained by the sex ratio, the greater herbivory of hermaphroditic flowers and the probable absence of pollinators.

Ambientes de cultivo, recipientes e substratos na produção de biomassa foliar e radicular em mudas de maracujazeiro amarelo em Aquidauana - MS

The objective of the work was to evaluate the effects of environment, recipients, and substrate compositions in passion fruit (Passiflora edulis Sims f. flavicarpa Deg.) seedlings biomass production in Pantanal region from September to November of 2006. Experimental trials were conducted in four protected environments, in two types of containers and three different substrate compositions. The environments were: A1 (greenhouse covered with low-density, 150-microns-thick polyethylene film), A2 (monofilament black screened with mesh for 50% of shade), A3 (aluminized screened with mesh for 50% of shade) and A4 (environment covered with straw of native coconut palm); the recipients were: polyethylene bags (R1) (15 x 25 cm) and polystyrene trays (R2) (with 72 cells). There substrates were: S1 (soil + organic compost + vermiculite, 1:1: 1 v/v), S2 (soil + organic compost + sawdust, 1:1: 1 v/v) and S3 (soil + organic compost + vermiculite + sawdust, 1:1: 1/2: 1/2 v/v). The experimental design was completely randomized statistical analysis in split-split-plot, with fifteen replications. The treatments in the plot were environments, in the subplots were pots, and subsubplots were substrates (4 x 2 x 3 = 24 treatments). Fresh and dry mass of aerial and root system parts were evaluated. Environments with screen showed better results for seedlings of yellow passion fruit biomass in polyethylene bags. Polyethylene bags promoted higher biomasses. The substrate with vermiculite showed better results for both types of containers. The substrate with a higher percentage of sawdust showed the worst result.

Inibidor da ação do etileno na conservação pós-colheita de Chrysanthemum morifolium Ramat cv. Dragon

The durability and postharvest quality of cut flowers are fundamental attributes in value along the production chain and in consumer satisfaction. The objective of this study was to evaluate the effect of chemical inhibitors of ethylene action on maintaining the postharvest quality of chrysanthemum stems (Chrysanthemum morifolium Ramat cv. Dragon). The experiment tested maintenance solutions with silver thiosulfate (STS) under five levels (distilled water, a 0.2 mM STS, the STS 0.2 mM + sucrose at 50 g L-1, STS at 0.4 mM; STS at 0.4 mM + sucrose at 50 g L-1), and date of sampling, for three levels (0, 3, 6 days). Three replications with two flower stems in each treatment were used in the experiment. Physical assessments were made: color, fresh mass and relative water content; chemical evaluations: reducing sugars and pigments, and qualitative assessments: turgidity, flower color, and number of buds, open flowers and partially open flowers. Treatment with 0.2 mM STS resulted in better maintenance of fresh mass of stems. The concentration of pigments and reducing sugar was higher in those treatments in which sucrose was associated. The color and relative water content were favored in treatments STS 0.2 mM and 0.4 mM. The concentration of 0.2 mM STS obtained the best results, prolonging the vase life the stems. The quality of these stems was higher, with the best assessments of water content, color and turgidity.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Minas-type fresh cheese developed from buffalo milk with addition of L. acidophilus

Effective incorporation of a probiotic into foods requires the culture to remain viable all along processing and storage, without adverse alterations to sensory characteristics. The objective of this work was developing Minas-type fresh cheese with probiotic properties from buffalo milk. Four batches of Minas-type fresh cheese were prepared using buffalo milk: batch T1 in which neither culture nor lactic acid added; batch T3 in which only lactic acid added; batches T2 and T4 , both added of Lactobacillus acidophilus LAC 4, but T4 was also acidified. Resulting cheeses were evaluated for probiotic culture stability, texture profile, sensory acceptance, and changes in pH. The T4 probiotic cheese presented hardness, gumminess, and chewiness significantly lower than the other treatments. However, values for springiness and cohesiveness did not differ between all cheeses, and no sensory differences (p > 0.05) were found between treatments for texture, taste, and overall acceptance. The addition of probiotic to the acidified cheese (T4) yielded best aroma. The populations of L. acidophilus were greater than 10(6) CFU g-1 after 28 days of storage all products. Minas-type fresh cheese from buffalo milk is a suitable food for the delivery of L. acidophilus, since the culture remained viable during the shelf life of the products and did not negative affect analysed parameters.

Allometric models for estimating the phytomass of a secondary Atlantic Forest area of southeastern Brazil

The purpose of this study was to develop and validate equations to estimate the aboveground phytomass of a 30 years old plot of Atlantic Forest. In two plots of 100 m², a total of 82 trees were cut down at ground level. For each tree, height and diameter were measured. Leaves and woody material were separated in order to determine their fresh weights in field conditions. Samples of each fraction were oven dried at 80 °C to constant weight to determine their dry weight. Tree data were divided into two random samples. One sample was used for the development of the regression equations, and the other for validation. The models were developed using single linear regression analysis, where the dependent variable was the dry mass, and the independent variables were height (h), diameter (d) and d²h. The validation was carried out using Pearson correlation coefficient, paired t-Student test and standard error of estimation. The best equations to estimate aboveground phytomass were: lnDW = -3.068+2.522lnd (r² = 0.91; s y/x = 0.67) and lnDW = -3.676+0.951ln d²h (r² = 0.94; s y/x = 0.56).

Modelos preditores da fitomassa aérea da Floresta Baixa de Restinga

Este estudo teve como objetivo desenvolver modelos preditores de fitomassa epigéa da vegetação arbórea da Floresta Baixa de Restinga. Foram selecionadas 102 árvores de 29 espécies ocorrentes na área de estudo e 102 indivíduos de jerivá (Syagrus romanzoffiana (Cham.) Glassman), distribuídos proporcionalmente entre as classes de diâmetro da vegetação arbórea. As árvores foram cortadas, ao nível do solo e foram medidos a altura total e o diâmetro à altura do peito (DAP) de cada árvore. As folhas foram separadas do lenho e a massa fresca da porção lenhosa e foliar medidas separadamente. Amostras de cada fração foram secas a 70 °C, até peso constante, para determinação da massa seca das árvores. Os modelos foram desenvolvidos através de análise de regressão linear, sendo a variável dependente a massa seca (MS) das árvores e as variáveis independentes a altura (h), o diâmetro a altura do peito (d) e as relações d² h e d² h multiplicada pela densidade da madeira (ρ d² h). Os modelos desenvolvidos indicam que o diâmetro explica grande parte da variabilidade da fitomassa das árvores da restinga e a altura é a variável explanatória da equação específica para o jerivá. Os modelos selecionados foram: ln MS (kg) = -1,352 + 2,009 ln d (R² = 0,96; s yx = 0,34) para a comunidade vegetal sem jerivá, ln MS (kg) = -2,052 + 0,801 ln d² h (R² = 0,94; s yx = 0,38) para a comunidade incluindo o jerivá, e ln MS (kg) = -0,884 + 2,40 ln h (R² = 0,92; s yx = 0,49) para o jerivá.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Maracujá: um alimento funcional?

Este artigo é uma revisão bibliográfica sobre as espécies brasileiras de Passiflora (Passiflora edulis fo. flavicarpa O. Deg., P. alata Curtis e P. edulis fo. edulis). A maioria dos artigos da literatura focaliza somente as folhas de Passiflora, enquanto que esta revisão contém informações sobre a polpa, cascas e sementes dos frutos do maracujá, com destaque para a composição química, estudos nutricionais e farmacológicos. O enfoque nos frutos do maracujá fundamenta-se no amplo consumo do suco de maracujá (fresco ou industrializado) no Brasil e também nas investigações em andamento para avaliar o seu potencial uso como alimento funcional.