Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Flora arbustivo-arbórea do fragmento de floresta estacional semidecidual do Ribeirão Cachoeira, município de Campinas, SP

An inventory of the woody flora (trees and shrubs), was carried out in the Ribeirão Cachoeria forest (233.7ha, 650m high, 46°55'58''W, 22°50'13''S), the second largest and best conserved fragment of semideciduous tropical forest in the municipality of Campinas, São Paulo state, Southeastern Brazil. The soil is a red-yellow podsol and the climate is of Köppen's Cwag type. Collections were made from August/1996 to September/1997. Only fertile individuals with a perimeter at breast height of 9cm or greater were included in the survey. One hyndred and seventhy five species were identified, belonging to 119 genera and 49 families. The most important families were Myrtaceae (14 species), Rutaceae and Fabaceae (13), Caesalpiniaceae (11), Solanaceae (9), and Rubiaceae (8). Some species were found for the first time in the region: Tachigali multijuga Benth. and Schoepfia brasiliensis A.DC. The flowering peak for most species was from August to October. Maximum fruit production was from August to November. Most species are zoochoric (58%), but 23% were anemochoric and 19% autochoric. The floristic composition of this forest and another 20 forests from São Paulo state were compared. The results obtained indicate the existence of distinct groups of forests. The most homogeneus group contains forests from the municipality of Campinas with similarity of 40%. This suggests that these forests are possibly fragments of a original continuous forest in the Campinas region.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

WOOD DENSITY VARIATION AND TREE RING DEMARCATION IN Gmelina arborea TREES USING X-RAY DENSITOMETRY

Due to its relationship with other properties, wood density is the main wood quality parameter. Modern, accurate methods - such as X-ray densitometry - are applied to determine the spatial distribution of density in wood sections and to evaluate wood quality. The objectives of this study were to determinate the influence of growing conditions on wood density variation and tree ring demarcation of gmelina trees from fast growing plantations in Costa Rica. The wood density was determined by X-ray densitometry method. Wood samples were cut from gmelina trees and were exposed to low X-rays. The radiographic films were developed and scanned using a 256 gray scale with 1000 dpi resolution and the wood density was determined by CRAD and CERD software. The results showed tree-ring boundaries were distinctly delimited in trees growing in site with rainfall lower than 25 10 mm/year. It was demonstrated that tree age, climatic conditions and management of plantation affects wood density and its variability. The specific effect of variables on wood density was quantified by for multiple regression method. It was determined that tree year explained 25.8% of the total variation of density and 19.9% were caused by climatic condition where the tree growing. Wood density was less affected by the intensity of forest management with 5.9% of total variation.

Variation in the wood anatomical structure of Gmelina arborea (Verbenaceae) trees at different ecological conditions in Costa Rica

The tree Gmelina arborea has been widely introduced in Costa Rica for commercial purposes. This new conditions for melina cause variations on anatomy in secondary xylem of the trees growing in plantations. The objective of the present research was to determine the variation in the anatomy of xylem caused by the ecological conduction variation. Dimensions of fiber, axial parenchyma percentage of cross sections, parameters of vessels and the ray were measured. The results showed that some anatomical characteristics remained stable despite variations of ecological conditions, especially radial parenchyma and anatomical features which were less affected by the altitude. On the other hand, the vessels, axial parenchyma and fiber were less stable because they were affected significantly by the longitude, latitude, altitude and precipitation. Latitude significantly affected vessel percentage, length and diameter of the fiber and lumen. Longitude affected vessel percentage and fiber diameter. Altitude had a significant correlation with the amount of cells at my height. Annual average precipitation affected vessel percentage and diameter, not only of the fiber, but also of the lumen. These results suggest that the new growth conditions of G. arborea trees in Costa Rica have produced an anatomic adaptation.

SELECTION OF TRICHOGRAMMA PRETIOSUM LINEAGES FOR CONTROL OF GRAPHOLITA MOLESTA IN PEACH

Grapholita molesta (Lepidoptera: Tortricidae) is one of the main pests of peach trees in Brazil, causing fruit losses of 3-5%. Among possible biological control agents, Trichogramma pretiosum (Hymenoptera: Trichogrammatidae) has been found in peach orchards. Our objectives were to study the rearing of T pretiosum in eggs of G. molesta and Anagasta kuehniella (Lepidoptera: Pyralidae), and select lineages of this parasitoid that have the potential to control G. molesta. Selection of best lineages was made from 5 populations of T pretiosum collected from organically-cultivated peach orchards. The study was done under controlled temperature (25 +/- 2 degrees C), relative humidity (70 +/- 10%) and 14:10 h (light:dark) photoperiod conditions. Grapholita molesta eggs were found to be adequate hosts for the development of T pretiosum, and the parameters for number of parasitized eggs, percent parasitized eggs, and sex ratio were similar to those for A. kuehniella eggs. The highest rate of parasitism of G. molesta eggs occurred in eggs with up to 48 h of embryonic development. Among the lineages of T pretiosum that were collected, HO8, PO8, PEL, and L3M showed the best biological performance and are therefore indicated for semi-field and field studies for biological control of oriental fruit moth.

Determination of banana fruit susceptibility to post-harvest diseases: wound anthracnose, quiescent anthracnose and crown rot

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.

Biochemical characterization of pulp of banana fruit: measurement of soluble sugars, organic acids, free ACC and in vitro ACC oxidase

Introduction. We present some protocols aiming at partially characterizing banana fruit quality through measurement of some key biochemical parameters. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. This part describes the required laboratory materials and the steps necessary for achieving four protocols making it possible to measure sugar, organic acids and free ACC contents, and in vitro ACC oxidase activity. Results. Standard results obtained by using the protocols described are presented in the figures.

Assessment of the potential genotoxic risk of medicinal Tamarindus indica fruit pulp extract using in vivo assays

Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.

The Missing Part of Seed Dispersal Networks: Structure and Robustness of Bat-Fruit Interactions

Mutualistic networks are crucial to the maintenance of ecosystem services. Unfortunately, what we know about seed dispersal networks is based only on bird-fruit interactions. Therefore, we aimed at filling part of this gap by investigating bat-fruit networks. It is known from population studies that: (i) some bat species depend more on fruits than others, and (ii) that some specialized frugivorous bats prefer particular plant genera. We tested whether those preferences affected the structure and robustness of the whole network and the functional roles of species. Nine bat-fruit datasets from the literature were analyzed and all networks showed lower complementary specialization (H(2)' = 0.3760.10, mean 6 SD) and similar nestedness (NODF = 0.5660.12) than pollination networks. All networks were modular (M=0.32 +/- 0.07), and had on average four cohesive subgroups (modules) of tightly connected bats and plants. The composition of those modules followed the genus-genus associations observed at population level (Artibeus-Ficus, Carollia-Piper, and Sturnira-Solanum), although a few of those plant genera were dispersed also by other bats. Bat-fruit networks showed high robustness to simulated cumulative removals of both bats (R = 0.55 +/- 0.10) and plants (R = 0.68 +/- 0.09). Primary frugivores interacted with a larger proportion of the plants available and also occupied more central positions; furthermore, their extinction caused larger changes in network structure. We conclude that bat-fruit networks are highly cohesive and robust mutualistic systems, in which redundancy is high within modules, although modules are complementary to each other. Dietary specialization seems to be an important structuring factor that affects the topology, the guild structure and functional roles in bat-fruit networks.