1000 resultados para Soil Formation


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

G-quadruplexes are secondary structures present in DNA and RNA molecules, which are formed by stacking of G-quartets (i.e., interaction of four guanines (G-tracts) bounded by Hoogsteen hydrogen bonding). Human PAX9 intron 1 has a putative G-quadruplex-forming region located near exon 1, which is present in all known sequenced placental mammals. Using circular dichroism (CD) analysis and CD melting, we showed that these sequences are able to form highly stable quadruplex structures. Due to the proximity of the quadruplex structure to exon-intron boundary, we used a validated double-reporter splicing assay and qPCR to analyze its role on splicing efficiency. The human quadruplex was shown to have a key role on splicing efficiency of PAX9 intron 1, as a mutation that abolished quadruplex formation decreased dramatically the splicing efficiency of human PAX9 intron 1. The less stable, rat quadruplex had a less efficient splicing when compared to human sequences. Additionally, the treatment with 360A, a strong ligand that stabilizes quadruplex structures, further increased splicing efficiency of human PAX9 intron 1. Altogether, these results provide evidences that G-quadruplex structures are involved in splicing efficiency of PAX9 intron 1.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Is the carrasco on the Ibiapaba plateau a unique plant formation? To answer this question the vertical height (except of climbers) and the stem basal diameter (from 3cm on) of woody plants were measured, and soil extracts (0-50 and 50-100cm depth) were taken from 100 random plots (10x10m) at Jaburuna (3º54'34S and 40º59'24W, altitudes near 830m), municipality of Ubajara, Ceará State. Data on climate, soil, diameter height, density, basal area, and physiognomy were compared with those surveyed by other researchers from the carrasco, caatinga, and cerrado in Northeastern Brazil. The carrasco occurs under an annual rainfall of between 668 and 1,289mm and temperatures from 22 to 24ºC, on alic Quartz Sand soils, at altitudes between 700 and 900m: it has a larger density and a smaller basal area than the caatinga and the cerrado, small and similar diameters, and an average vertical height between 3,7 and 5,4m. It differs from the caatinga, cerrado (and cerradão) and secondary forest in many items of lhe ecotope, organization and physiognomy, thus being a unique plain formation, which can be characterized as a deciduous, high, closed, and unistratified shrubland intermingled by lianas, with an irregular canopy and sparse, emergent trees.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Several native herbaceous and subshrub species native to the Cerrado in Brazil are geophytes, that is, they survive the unfavorable dry season and low temperatures, that sometimes coincide with fire, with only the underground system intact. Vernonia oxylepis is one of these species and the aim of this study was to describe the morpho-anatomy of the tuberous root and bud formation on this structure. The main axis of this root is perpendicular to the soil surface, and from which aerial shoots arise periodically throughout the life cycle. On the upper portion of the root, self-grafting of the shoots occurs. The root stores lipids and fructans, exhibits contraction and produces reparatory buds; adventitious buds arise from proliferated pericycle. These characteristics may be related to adaptation of this species to conditions in the Cerrado.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study aimed to evaluate the effects of a flavor-containing dentifrice on the formation of volatile sulphur compounds (VSCs) in morning bad breath. A two-step, blinded, crossover, randomized study was carried out in 50 dental students with a healthy periodontium divided into two experimental groups: flavor-containing dentifrice (test) and non-flavor-containing dentifrice (control). The volunteers received the designated dentifrice and a new toothbrush for a 3 X/day brushing regimen for 2 periods of 30 days. A seven-day washout interval was used between the periods. The assessed parameters were: plaque index (PI), gingival index (GI), organoleptic breath scores (ORG), VSC levels (as measured by a portable sulphide monitor) before (H1) and after (H2) cleaning of the tongue, tongue coating (TC) wet weight and BANA test from TC samples. The intra-group analysis showed a decrease in ORG, from 3 to 2, after 30 days for the test group (p < 0.05). The inter-group analysis showed lower values in ORG, H1 and H2 for the test group (p < 0.05). There was no difference between the amount of TC between groups and the presence of flavor also did not interfere in the BANA results between groups (p > 0.05). These findings suggest that a flavor-containing dentifrice seems to prevent VSCs formation in morning bad breath regardless of the amount of TC in periodontally healthy subjects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

PURPOSE: Dental fusion is defined as the union of two dental germs at some stage of their development. The aim of this article is to report the endodontic treatment of two clinical cases of dental fusion. CASE DESCRIPTION: In the first case, the patient was referred by an orthodontist for endodontic treatment of tooth 12, which was fused to 13. Surgical separation and later replacement of the involved elements in the dental arch was indicated. In the second case, the patient sought dental attendance due to spontaneous pain. In the radiographic exam, gemination in tooth 11 and fusion of 21 with a supernumerary tooth was observed. The fused teeth were endodontically treated, and patients were referred to other dental specialties to reestablish esthetics and function. CONCLUSION: The dentist must be able to diagnose, differentiate and treat these dental anomalies adequately, with the goal of maintaining patients' oral health.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Gaseous N losses from soil are considerable, resulting mostly from ammonia volatilization linked to agricultural activities such as pasture fertilization. The use of simple and accessible measurement methods of such losses is fundamental in the evaluation of the N cycle in agricultural systems. The purpose of this study was to evaluate quantification methods of NH3 volatilization from fertilized surface soil with urea, with minimal influence on the volatilization processes. The greenhouse experiment was arranged in a completely randomized design with 13 treatments and five replications, with the following treatments: (1) Polyurethane foam (density 20 kg m-3) with phosphoric acid solution absorber (foam absorber), installed 1, 5, 10 and 20 cm above the soil surface; (2) Paper filter with sulfuric acid solution absorber (paper absorber, 1, 5, 10 and 20 cm above the soil surface); (3) Sulfuric acid solution absorber (1, 5 and 10 cm above the soil surface); (4) Semi-open static collector; (5) 15N balance (control). The foam absorber placed 1 cm above the soil surface estimated the real daily rate of loss and accumulated loss of NH3N and proved efficient in capturing NH3 volatized from urea-treated soil. The estimates based on acid absorbers 1, 5 and 10 cm above the soil surface and paper absorbers 1 and 5 cm above the soil surface were only realistic for accumulated N-NH3 losses. Foam absorbers can be indicated to quantify accumulated and daily rates of NH3 volatilization losses similarly to an open static chamber, making calibration equations or correction factors unnecessary.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ferruginous "campos rupestres" are a particular type of vegetation growing on iron-rich primary soils. We investigated the influence of soil properties on plant species abundance at two sites of ferruginous "campos rupestres" and one site of quartzitic "campo rupestre", all of them in "Quadrilátero Ferrífero", in Minas Gerais State, southeastern Brazil. In each site, 30 quadrats were sampled to assess plant species composition and abundance, and soil samples were taken to perform chemical and physical analyses. The analyzed soils are strongly acidic and presented low fertility and high levels of metallic cations; a principal component analysis of soil data showed a clear segregation among sites due mainly to fertility and heavy metals content, especially Cu, Zn, and Pb. The canonical correspondence analysis indicated a strong correlation between plant species abundance and soil properties, also segregating the sites.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The mineralogical characterization through mineral quantification of Brazilian soils by X-ray diffraction data using the Rietveld Method is not common. A mineralogical quantification of an Acric Ferralsol from the Ponta Grossa region, state of Paraná, Brazil, was carried out using this Method with X-Ray Diffraction data to verify if this method was suitable for mineral quantification of a highly-weathered soil. The A, AB and B3 horizons were fractioned to separate the different particle sizes: clay, silt, fine sand (by Stokes Law) and coarse sand fractions (by sieving), with the procedure free of chemical treatments. X-ray Fluorescence, Inductively Coupled Plasma Atomic Emission Spectrometry, Infrared Spectroscopy and Mössbauer Spectroscopy were used in order to assist the mineral identification and quantification. The Rietveld Method enabled the quantification of the present minerals. In a general way, the quantitative mineralogical characterization by the Rietveld Method revealed that quartz, gibbsite, rutile, hematite, goethite, kaolinite and halloysite were present in the clay and silt fractions of all horizons. The silt fractions of the deeper horizons were different from the more superficial ones due to the presence of large amounts of quartz. The fine and the coarse sand fractions are constituted mainly by quartz. Therefore, a mineralogical quantification of the finer fraction (clay and silt) by the Rietveld Method was successful.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The potential of charcoal and of partially combusted organic waste to mimic the soil organic matter of the Terras Pretas de Índios (Amazonian Dark Earths) from the Amazon Region is discussed. These materials serve as soil conditioners and as sequesterers of carbon in recalcitrant and in reactive forms. Studies carried out by Brazilian and by international groups have contributed to the emergence of an awareness of the compositions and of the uses of these materials. In this contribution we report on chemical studies that are leading to the development of a scientific and technological awareness, and of innovations that will have value in finding novel uses in applications to soil of chars from organic wastes such as those from the biofuel industry, and from metallurgical and various coal plant residues.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this study, sedimentary organic matter of oil shale rejects, calschist, shale fine and the so called retorted shale from Irati formation was characterized. EPR was used to analyse the samples regarding loss of signal in g = 2.003 associated to the organic free radical with the calcined samples and washing with hydrogen peroxide. The radical signal was detected in all samples, however, for the calschist and shale fine samples another signal was identified at g = 2.000 which disappeared when the sample was heated at 400 ºC. Hydrogen peroxide washing was also performed and it was noted that after washing the signal appeared around g = 2.000 for all samples, including retorted shale, which might be due to the quartz E1 defect.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This paper examines the role of parent rock, pedogenetic processes and airborne pollution in heavy metal accumulation in soils from a remote oceanic island, Fernando de Noronha, Brazil. We studied five soil profiles developed from different volcanic rocks. Mineralogical composition and total concentrations of major and trace elements were determined in 43 samples. The obtained concentrations range for heavy metals were: Co: 26-261 ppm; Cu: 35-97 ppm; Cr: 350-1446 ppm; Ni: 114-691 ppm; Zn: 101-374 ppm; Hg: 2-150 ppb. The composition of soils is strongly affected by the geochemical character of the parent rock. Pedogenesis appears to be responsible for the accumulation of Zn, Co, and, to a lesser extent, of Ni and Cu, in the upper, Mn- and organic carbon-enriched horizons of the soil profiles. Pedogenic influence may also explain the relationship observed between Cr and the Fe. Hg is likely to have been added to the soil profile by long-range atmospheric transport. Its accumulation in the topsoil was further favoured by the formation of stable complexes with organic matter. Clay minerals do not appear to play an important role in the fixation of heavy metals.