980 resultados para Past events recollection
Resumo:
This article analyses the context of production and local situations of appropriation and resignification related to the folk song “Fire on Animaná” as well as the request and mobilization (“The animanazo”) provoked by this song in order to examine different mechanisms and foundations by which a population connect with an event from its community past, identifying with this and taking it in a specific way. In this article we combine discourse analysis of the song and of interviews to participants in this event with the reconstruction —through ethnographic observation— of how to use this song.
Resumo:
The branched vs. isoprenoid tetraether (BIT) index is based on the relative abundance of branched tetraether lipids (brGDGTs) and the isoprenoidal GDGT crenarchaeol. In Lake Challa sediments the BIT index has been applied as a proxy for local monsoon precipitation on the assumption that the primary source of brGDGTs is soil washed in from the lake's catchment. Since then, microbial production within the water column has been identified as the primary source of brGDGTs in Lake Challa sediments, meaning that either an alternative mechanism links BIT index variation with rainfall or that the proxy's application must be reconsidered. We investigated GDGT concentrations and BIT index variation in Lake Challa sediments at a decadal resolution over the past 2200 years, in combination with GDGT time-series data from 45 monthly sediment-trap samples and a chronosequence of profundal surface sediments.
Our 2200-year geochemical record reveals high-frequency variability in GDGT concentrations, and therefore in the BIT index, superimposed on distinct lower-frequency fluctuations at multi-decadal to century timescales. These changes in BIT index are correlated with changes in the concentration of crenarchaeol but not with those of the brGDGTs. A clue for understanding the indirect link between rainfall and crenarchaeol concentration (and thus thaumarchaeotal abundance) was provided by the observation that surface sediments collected in January 2010 show a distinct shift in GDGT composition relative to sediments collected in August 2007. This shift is associated with increased bulk flux of settling mineral particles with high Ti / Al ratios during March–April 2008, reflecting an event of unusually high detrital input to Lake Challa concurrent with intense precipitation at the onset of the principal rain season that year. Although brGDGT distributions in the settling material are initially unaffected, this soil-erosion event is succeeded by a massive dry-season diatom bloom in July–September 2008 and a concurrent increase in the flux of GDGT-0. Complete absence of crenarchaeol in settling particles during the austral summer following this bloom indicates that no Thaumarchaeota bloom developed at that time. We suggest that increased nutrient availability, derived from the eroded soil washed into the lake, caused the massive bloom of diatoms and that the higher concentrations of ammonium (formed from breakdown of this algal matter) resulted in a replacement of nitrifying Thaumarchaeota, which in typical years prosper during the austral summer, by nitrifying bacteria. The decomposing dead diatoms passing through the suboxic zone of the water column probably also formed a substrate for GDGT-0-producing archaea. Hence, through a cascade of events, intensive rainfall affects thaumarchaeotal abundance, resulting in high BIT index values.
Decade-scale BIT index fluctuations in Lake Challa sediments exactly match the timing of three known episodes of prolonged regional drought within the past 250 years. Additionally, the principal trends of inferred rainfall variability over the past two millennia are consistent with the hydroclimatic history of equatorial East Africa, as has been documented from other (but less well dated) regional lake records. We therefore propose that variation in GDGT production originating from the episodic recurrence of strong soil-erosion events, when integrated over (multi-)decadal and longer timescales, generates a stable positive relationship between the sedimentary BIT index and monsoon rainfall at Lake Challa. Application of this paleoprecipitation proxy at other sites requires ascertaining the local processes which affect the productivity of crenarchaeol by Thaumarchaeota and brGDGTs.
Resumo:
Thesis (Ph.D.)--University of Washington, 2016-08
Resumo:
Objectif: Examiner l’association entre l'exposition aux évènements stressants de la vie et le cancer du poumon. Méthodes: Les données proviennent d’une étude cas-témoins, menée chez les hommes et les femmes vivant dans la région métropolitaine de Montréal entre 1996 et 2001. Le cancer du poumon d’un cas éligible devait être confirmé histologiquement à l’un des 18 hôpitaux de cette région. Les témoins ont été sélectionnés aléatoirement de la liste électorale du Québec et ont été appariés au cas par fréquence de groupes d'âge et par sexe. Un questionnaire a été administré en entrevue pour recueillir les données, dont l’évaluation de huit évènements stressants de la vie par le participant. Si le participant avait vécu un évènement stressant ciblé durant les six dernières années, il devait aussi coter cet évènement sur une échelle de trois points. La régression logistique non conditionnelle a été utilisée pour estimer les rapports de cotes ainsi que leurs intervalles de confiance à 95%. Des analyses par sexe, niveau de tabagisme et par type histologique ont été réalisées. Nous avons aussi analysé l’association entre le cancer du poumon et le nombre total d'évènements, les évènements de perte et les évènements socioéconomiques, ainsi que chaque évènement individuellement. Les analyses des scores d'impact autoévalués et avec un score externe de perception, ont également été menées. Résultats: La population de ce projet comprend 1061 cas et 1422 témoins, âgés de 35 à 70 ans. Les participants inclus avaient répondu aux sections du questionnaire portant sur les facteurs de style de vie et sur l'historique de tabagisme. Dans l'ensemble, nous n’avons pas observé d’association entre le cancer du poumon et l'exposition aux évènements stressants de la vie. Nous avons observé une diminution du risque pour les évènements socioéconomiques autoévalués comme peu stressants (RC=0,50; IC 95%= 0,31 - 0,81). Conclusion: Nos résultats suggèrent que les évènements socioéconomiques sont associées à un risque réduit si ces évènements sont considérés comme peu stressant.
Resumo:
Objectif: Examiner l’association entre l'exposition aux évènements stressants de la vie et le cancer du poumon. Méthodes: Les données proviennent d’une étude cas-témoins, menée chez les hommes et les femmes vivant dans la région métropolitaine de Montréal entre 1996 et 2001. Le cancer du poumon d’un cas éligible devait être confirmé histologiquement à l’un des 18 hôpitaux de cette région. Les témoins ont été sélectionnés aléatoirement de la liste électorale du Québec et ont été appariés au cas par fréquence de groupes d'âge et par sexe. Un questionnaire a été administré en entrevue pour recueillir les données, dont l’évaluation de huit évènements stressants de la vie par le participant. Si le participant avait vécu un évènement stressant ciblé durant les six dernières années, il devait aussi coter cet évènement sur une échelle de trois points. La régression logistique non conditionnelle a été utilisée pour estimer les rapports de cotes ainsi que leurs intervalles de confiance à 95%. Des analyses par sexe, niveau de tabagisme et par type histologique ont été réalisées. Nous avons aussi analysé l’association entre le cancer du poumon et le nombre total d'évènements, les évènements de perte et les évènements socioéconomiques, ainsi que chaque évènement individuellement. Les analyses des scores d'impact autoévalués et avec un score externe de perception, ont également été menées. Résultats: La population de ce projet comprend 1061 cas et 1422 témoins, âgés de 35 à 70 ans. Les participants inclus avaient répondu aux sections du questionnaire portant sur les facteurs de style de vie et sur l'historique de tabagisme. Dans l'ensemble, nous n’avons pas observé d’association entre le cancer du poumon et l'exposition aux évènements stressants de la vie. Nous avons observé une diminution du risque pour les évènements socioéconomiques autoévalués comme peu stressants (RC=0,50; IC 95%= 0,31 - 0,81). Conclusion: Nos résultats suggèrent que les évènements socioéconomiques sont associées à un risque réduit si ces évènements sont considérés comme peu stressant.
Resumo:
Ribot’s law refers to the better preservation of remote memories compared with recent ones that presumably characterizes retrograde amnesia. Even if Ribot-type temporal gradient has been extensively studied in retrograde amnesia, particularly in Alzheimer’s disease (AD), this pattern has not been consistently found. One explanation for these results may be that rehearsal frequency rather than remoteness accounts for the better preservation of these memories. Thus, the aim of present study was to address this question by studying retrograde semantic memory in subjects with amnestic mild cognitive impairment (aMCI) (n = 20), mild AD (n = 20) and in healthy older controls (HC; n = 19). In order to evaluate the impact of repetition as well as the impact of remoteness, we used a test assessing memory for enduring and transient public events that occurred in the recent and remote past. Results show no clear temporal gradient across time periods (1960–1975; 1976–1990; 1991–2005; 2006–2011), but a better performance was observed in all three groups for enduring compared with transient events. Moreover, although deficits were globally found in both patients groups compared with HC, more specific analyses revealed that aMCI patients were only impaired on transient events while AD patients were impaired on both transient and enduring events. Exploratory analyses also revealed a tendency suggesting preservation of remote transient events in aMCI. These findings are discussed with regards to memory consolidation models.
Resumo:
The past few decades have seen major impacts of different pandemics and mass casualty events on health resource use in terms of rising health cost and increased mortality.
Resumo:
The severe accidents deriving from the impact of natural events on industrial installations have become a matter of growing concern in the last decades. In the literature, these events are typically referred to as Natech accidents. Several peculiarities distinguish them from conventional industrial accidents caused by internal factors, such as the possible occurrence of multiple simultaneous failures, and the enhanced probability of cascading events. The research project provides a comprehensive overview of Natech accidents that occurred in the Chemical and Process Industry, allowing for the identification of relevant aspects of Natech events. Quantified event trees and probability of ignition are derived from the collected dataset, providing a step forward in the quantitative risk assessment of Natech accidents. The investigation of past Natech accidents also demonstrated that wildfires may cause technological accidents. Climate change and global warming are promoting the conditions for wildfire development and rapid spread. Hence, ensuring the safety of industrial facilities exposed to wildfires is paramount. This was achieved defining safety distances between wildland vegetation and industrial equipment items. In addition, an innovative methodology for the vulnerability assessment of Natech and Domino scenarios triggered by wildfires was developed. The approach accounted for the dynamic behaviour of wildfire events and related technological scenarios. Besides, the performance of the emergency response and the related intervention time in the case of cascading events caused by natural events were evaluated. Overall, the tools presented in this thesis represent a step forward in the Quantitative Risk Assessment of Natech accidents. The methodologies developed also provide a solid basis for the definition of effective strategies for risk mitigation and reduction. These aspects are crucial to improve the resilience of industrial plants to natural hazards, especially considering the effects that climate change may have on the severity of such events.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
Universidade Estadual de Campinas . Faculdade de Educação Física
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)