999 resultados para João Pessoa
Resumo:
This research, whose theme is related to climacteric, aims to know the social representation of menopause developed by the nurses working for Estratégia Saúde da Família (Family Health Strategy) in João Pessoa PB, as well as identifying its structure and verifying the way it interferes with the assistance and educational practices to the climacterial user. In the theoretical level, it is based on a model that articulates the social representations theory, the central nucleus complementary theory and the central concepts of Pierre Bourdieu s praxiology: habitus, cultural capital, social field and symbolic power. A hundred and forty-seven female nurses who work for Estratégia Saúde da Família (Family Health Strategy) in João Pessoa (PB) took part in this research, and the data collection period was from February 2008 to March 2009. As to the methods and techniques, we used the method to determine the central nucleus based on the free association of words, a questionnaire to identify certain regularities that constitute the nurses habitus, and the semi-structured interview to explore opinions and attitudes when facing assistance situations and educational practices and to collect other relevant information. The data analysis was developed, when referring to the free associations, with the help of the EVOC software, which is a group of articulated programs which carry out the statistical analysis of the evocations and the identification of the possible elements of both the central nucleus and the peripheral system of the social representation. As to the questionnaire, we used the descriptive statistical analysis and the analysis of correlation between the variables. The interviews were submitted to a categorical analysis of the content. The EVOC result indicated that the cognition hormone was the only element of the central nucleus of the social representation of menopause. Due to its symbolic value and structuring power, this central nucleus ensures the strict and, at the same time, flexible character of the representational content. The analysis of the social advancement, of some fundamental features of the group habitus, as well as the analysis of its insertion in the health field and of the attitudinal opinions and dispositions concerning the assistance given to the climacterial user, and the analysis of the pedagogical dimension of this assistance, all these analyses lead to the conclusion that the nurses who took part in this research share a social representation of the menopause resulting from the association of different technical and scientific knowledge. These derive from the biomedical pattern as well as from hegemonic values which disqualify old age and overvalue youth, from pedagogical conceptions arising from patterns that are presently regarded as authoritative and old-fashioned and from cultural references (responsible for the semantic variations concerning the central nucleus) which are specific to the subgroups the nurses belong to. This research enables the creation of opportunities for discussion between active nurses working for Estratégia Saúde da Família, and the nurses who are teachers at institutions of higher education, aiming at linking theory to practice, so that they can find ways of thinking about the climacteric and working, in a more comprehensive way, with users who are experiencing this stage of life
Resumo:
Plongés dans le temps présent, les dessins humoristiques, par la capacité de représenter, de suggérer et de communiquer une idée, marquent présence à l école et dans la salle de classe. Caractérisés par l utilisation d éléments comiques, satiriques et irôniques, outre la nature persuasive, ces dessins possibilitent le lecteur de faire une lecture critique des événements sociaux et politiques de notre société. En tant que langage visuel, structuré dans les formes verbale et icônique, de même que par le caractère analogique de représentation, les dessins humoristiques constituent un excellent recours pédagogique. Toutefois, ils sont longtemps restés inaperçus par l école et, seul récemment, ils sont devenus objet d investigation de la part des historiens. Dans ce sens, nous nous sommes proposés, dans cette étude, à analyser l utilisation de ces dessins par les professeurs d histoire des écoles publiques nommées Centros Paraibanos de Educação Solidária (CEPES), de João Pessoa, capitale de l Etat de Paraíba, en vue d appréhender et de discuter la façon dont ces professeurs font usage de ces dessins dans leur pratique pédagogique. Par le moyen des actions des professeurs, conçues comme des arts de faire, selon Certeau, et par l identification des usages qui se caractérisent comme des tactiques, nous avons essayé de percevoir comment se réalise le rapport humour et histoire, en salle de classe. La systématisation, la catégorisation et la narration des pratiques pédagogiques observées ont été réalisées par l analyse des questionnaires et des interviews appliqués aux professeurs et élèves, ainsi qu à l observation des classes. Notre recherche s est fondée sur les théories de Roger Chartier et Michel de Certeau, dont les concepts de représentation et d appropriation, d usages et de tactiques nous ont aidé à comprendre la forme par laquelle les sujets incorporés au quotidien de la salle de classe se sont appropriés de la dimension imagétique à travers l humour. A partir des concepts d usage et d appropriation nous avons identifié dans les actions et les parlers, la façon dont les dessins humoristiques sont travaillés par les professeurs. Conçus comme des registres visuels qui relatent des questions sociales, politiques et économiques, ces dessins sont perçus comme des registres visuels qui relatent des questions sociales, politiques et économiques, identifant, ainsi, les adversités du présent, dans le monde social
Resumo:
Study about the teaching-learning process in History, which intents to point limits and possibilities to this process, starting from its characterization and analysis and understanding of the concepts of history, time, society and culture, used by teachers and students. The field research was performed in the Municipal School of Basic Education Zumbi dos Palmares, located in the city of João Pessoa, Paraíba State, in the period between 1996 and 2006. To achieve the objective of the study, a number of research instruments were used, amongst which, interviews, questionnaires and exercises emphasizing conceptual learning. The theoretical-methodological premises of the qualitative research justify the use of these various instruments, and serve as base for the interpretation and analysis of the data. This study demonstrated that some limits and possibilities that are found in the teaching-learning process in History are originated in the school context of the 1st phase of basic education and remain in the 2nd phase of this education level, partly, because of the understanding that teachers and students have regarding the concepts of history, time, society and culture
Resumo:
The Community Therapy (CT) is in a practice of therapeutic effect and may also be considered as a technology takes care of the therapeutic procedure group, whose purpose is to promote health, prevent illness, developed within primary care in mental health. In this study we sought to understand the social representations of health professionals who work with the Community Therapy, on use of the Family Health Strategy (FHS) in the city of Joao Pessoa. This is a field research with a qualitative view Moscovician Theory of Social Representations, held with seven professionals of the FHS, therapists of Community Health District II. The empirical data were obtained by carrying out two thematic therapies in April 2009, which were wheeled CT. It was used as a technique for analyzing the collective subject discourse, and the data presented through graphs, charts, maps, pictures and graphics and arranged in three stages: Subjects of the study, characterizing the study participants; Social Representations of Therapist Community presenting and discussing the social representations of therapists community studied on CT, and Consequences of Community Therapy at the Family Health Strategy, discussing the meanings attributed by the study participants about changes in FHS. Meanings were attributed to the CT by the therapists studied originated from the speeches, songs, drawings and constructed, and that presented by schematic illustration show the relation between the representations: life, listening, faith / light, change, transformation. The web, symbol of CT, appeared on the images constructed by the representatives of the study and represents the formation of bonds that allows the construction of social support networks that strengthen relationships among community. In the study, proved by professionals who have the meanings about the changes in the work process from the introduction of CT, and shown that the change took place within a more welcoming attitude on the part of professionals, the relationship between Team members had no significant changes, explained by the low compliance of team members to the CT in relation to the user front, the bond was strengthened, and this involved strengthening the role of the therapist community. It is recognized, thereby transforming the character of CT in building links with users, requiring, however, that the team is viewed as offering therapeutic services, not the professional therapist. Therefore, the CT for being a new phenomenon in health services and community belonging, it fits like a novelty which affects the construction of a representation dispute. Still, can contribute to the reorganization of mental health care in line with the new model of mental health care advocated by the Psychiatric Reform.
Resumo:
Communication is seen as vital function. Through it, individuals and organizations relate to each other, the environment and the shares of their own group, influencing each other to turn facts into information. The user of the male part of a group of patients whose health policy is still in development. This fact can create insecurity in the nurse to establish a process that promotes disease prevention, promotion and / or recovery of health for that user. Aiming to elucidate this, the present study aimed to: apprehend the social representations of nurses communication with the users were male, looking for disease prevention, promotion and recovery of his health; identify the factors that influenced, positively or negatively on the effectiveness of nurses communication with the users were male and investigate the strategies used by nurses to clarify communication with the users were male. In order to achieve the goal raised, this study was a descriptive, exploratory and qualitative approach. Was based on theoretical and methodological framework social representations of Denise Jodelet and Serge Moscovici. The project has, through no Parecer nº 649/10, approval of the Ethics and Research HULW. During data collection, we used a semi-structured script and a diary interviews with 24 nurses in basic health units of district-Mangabeira Health District III, the city of João Pessoa (PB). The results were analyzed using the technique of content analysis according to Bardin (2007). Classifying the research subjects and identified three categories and five nuclei of the central ideas. The categories identified: the grasp of the RS communication of nurses with male users, identifying factors that influence the effectiveness of nurses' communication with users and male research on the strategies used by nurses to the elucidation of the communication with male users. The nuclei of the central ideas found: social representations of nurses' communication with the users of the male is externalized as difficult, different, difficult, not technical (knowledge) specific, with a dubious sense in relation to its therapeutic action, the factors examined as positive in this communication were based on the connection between professional and user look in detail and not mechanistic, in preventive actions, the dynamics of care, accessibility, participatory care, humanization, and qualification service. Whereas served as negative factors for the communication, signed on the behavioral differences of men, the feminization of nurses, lack of training for professionals in relation to the subject, prescriptive conduct and prejudice (concerns) sociocultural. Another related consolidated core strategies employed for the occurrence of such communication. Given these results, it was realized the importance of social representations for the consecration of a single language, the common understanding of reality on the nurse's communication with the user in male and determination of changes in the behavior of nurses and the user to the establishment of more effective strategies for obtaining a therapeutic communication between them
Resumo:
The counseling on HIV/Aids consists in a prevention strategy that contributes to increase the diagnosis of HIV and start earlier the treatment. The counseling has as pillars the emotional and educational support, risks evaluation that aim at the adoption of safe practices and the individual s responsibility for his own health. To accomplish these results, it is necessary that health workers understand counseling as a unique educational moment that stimulates the user s critical-reflection when it comes to his role as an active subject in this process. This study aimed to analyze the counseling on HIV/Aids conducted by the professionals of the Testing and Counseling Center (CTA), based on the educational perspective of Paulo Freire . This is a descriptive qualitative study with a critical reflexive design based on the principles of Action-Science. All the professionals acting as counselors in the Joao Pessoa, PB CTA, eight in total, took part in the study. Data were collected during the month of March, 2011, through non participative observation and semi-structured interviews with a critical-reflexive focus, analyzed according to the tenets of the critical-reflexive methodology, and discussed taking into consideration the Paulo Freire s pedagogy and pertinent literature. It was observed that most of the professionals expressed the work philosophy of CTA as the diagnosis and prevention of the disease, associated with the utilization and demonstration of condoms. However, upon observation of their counseling sessions, these ideas were not converted in actions. Educational themes were not covered and the condom wasn t offered at any time. The counseling actions focused on the provision of information and filling out the paper forms which are necessary for attendance. The sessions were conducted with brief dialogues and little opportunity for the users to expose or complement their thoughts and needs. The professionals mentioned as facilitating conditions for counseling, the team interaction and physical structure. The difficulties focused on the users low cognition, the large demand for attendance, aspects related to the service organization, and the counselors absences and delays. After reflecting about the actions observed in the counseling, the majority of professionals admitted the need to modify their practice in the incorporation of educational principles for the achievement of a broader prevention, and seemed to be willing to work in this perspective. In conclusion, although the counselors show ideas consistent with the purposes of CTA, these ideas are limited when it comes to the understanding of the meaning of prevention in HIV/Aids. Taking into consideration that they express a certain comprehension and act differently during the counseling, they demonstrate a lack of bond between the theories in use and the proposed ones, in accordance with the contribution of the action-science theory. The counseling, as an educative practice, doesn t materialize in the counseling itself and the orientation for reflection is not given during the attendance. These findings suggest the need to include the process of reflection in the execution of the actions of counseling, so that these practices are guided by reflexive practice, aiming at transforming the way of thinking and acting into a more educational perspective toward a more democratic and holistic assistance.
Resumo:
This dissertation has the purpose to present a portable device named PlugData MG100G, equipped with a cellular module, to analyze the radiofrequency coverage in a GSM network situated in João Pessoa city, state of Paraíba, at four distinct regions. The equipment, originally, was developed to be used in fixed environments, so it was adapted so that it could be used in conditions of mobility. From the Mobile Measurement Reports (MMRs) RF coverage and the handover process are analyzed. The MMRs enable the identification of the serving cell and the list of the closest neighboring cells monitored by the mobile. This work analyses only data referent to the serving cell and the two closest neighboring cells. Inter-cell and intra-cell handovers are identified. The frequency planning and quality of service offered by the network related to the regions are discussed as well
Resumo:
This paper presents an analysis of technical and financial feasibility of the use of a solar system for water heating in a fictitious hotel located in the Northeast region. Thereunto it is used techniques of solar collectors´ sizing and methods of financial mathematics, such as Net Present Value (NPV), Internal Rate of Return (IRR) and Payback. It will also be presented a sensitivity analysis to verify which are the factors that impact the viability of the solar heating. Comparative analysis will be used concerning three cities of distinct regions of Brazil: Curitiba, Belém and João Pessoa. The viability of using a solar heating system will be demonstrated to the whole Brazil, especially to the northeast region as it is the most viable for such an application of solar power because of its high levels of solar radiation. Among the cities examined for a future installation of solar heating systems for water heating in the hotel chain, João Pessoa was the one that has proved more viable.
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
The current research had as main objective to analyze the possibility of knowledge elaboration/re-elaboration about ideas and algorithmic procedures related to basic operations by pupils of the 6th degree fundamental teaching in a significant learning process. This way the study had as basis a methodological intervention developed in a 6th degree class of a Fundamental Teaching Municipal School in the city of João Pessoa, PB. The research had as central steps the application of pre-tests (1 and 2); the execution of semi-structured interviews with the pupils involved in the theme deep studies; the elaboration and development of teaching activities, having as referential the significant learning and the application of a pre-test. The data collected in the pre-tests (1 and 2) showed a low level of the pupils comprehension about the contents related to the four operations. The answers to the post-test questions were analyzed mainly from the qualitative point of view based on the mathematic concepts comprehension theory proposed by Skemp (1980) having as complementary subsidy data collected through interviews. The analysis of the results obtained in the post-test showed that the major part of pupils reached a relational comprehension about the ideas and algorithmic procedures related to addition, subtraction, multiplication, and division. Such results showed us that the application of a teaching methodology that privileges the content comprehension, considering the pupils previous knowledge and the reflection about the action along the activities proposed, made possible the elaboration or re-elaboration of knowledge by pupils regarding to contents adopted as theme for our research
Resumo:
Introduction: The aging process causes quantitative and qualitative changes in sleeping. Such changes affects more than half of the adults above 65 years old, that live in the community and 70% of the institutionalized, a great negative impact in their quality of life. One of the pathological displays of aging, that share some characteristics with sleeping disorders and predict similar results, is the Frailty Syndrome, that characterize the most weakened and vulnerable elderly. The way sleeping disorders play a role in the frailty pathogeneses remains uncertain. Objective: Evaluate the relation between the sleeping and the frailty syndrome on institutionalized elderly. Methodology: A transversal study was performed with 69 elderly in institutions in the city of João Pessoa PB. Were used the Pittsburgh Sleeping Quality Index and actigraphy to subjective and objective variables, respectively, and questionnaires and specific tests to frailty phenotype variant (Fried Frailty Criteria). In the statistic analysis were used the Pearson correlation test, Chi Square and One-way ANOVA test, with Tukey-Krammer posttest. Subsequently, a Simple Linear Regression model was built. On every statistical analysis were considered a confidence interval of 95% and a p < 0,05. Results: The sample was characterized by the prevalence of the frail (49,3%), women (62,3%), single (50,7%) and 77,52 (±7,82).The frail elderly obtained the worst sleeping quality 10,37 (±4,31) (f = 4,15, p = 0,02), when compared with the non-frail. The sleep latency influenced more the frailty (R2 = 0,13, β standard = 1,76, β = 0,41, p = 0,001). Weren t found differences between the standard resting-activity variable and the frailty phenotype categories. Conclusion: Sleeping alterations, including bad sleeping quality, prolonged sleep latency, low sleep efficiency and day drowsiness, influenced the frailty in institutionalized elderly
Resumo:
Introduction: The Frailty Syndrome is characterized by the decrease of energy reserve and the reduced resistance to stressors. Studies indicate that the neuroendocrine markers can be related to the appearance of this syndrome. The main endocrine answer to stress is the increase of cortisol levels. Objective: To analyze the correlation between the frailty syndrome the salivary cortisol in elderly residing in nursing homes. Method: A traversal study was accomplished, in João Pessoa city, PB, with a sample composed by 69 institutionalized elderly. The collected data refer to the frailty phenotype (weight loss, exhaustion, slowness, weakness, and lower level of physical activity) and to salivary cortisol parameters (first measure - 6-7h; second measure - 11-12h; third measure - 16-17h). In the statistical analysis the Pearson s correlation test was used, Chi square Test and Anova and Simple Linear Regression analyses. Results: The sample was composed by 37.7% of men and 62.3% of women, with age average of 77.52 (±7.82). There was a percentile of 45.8% frail elderly. The frail elderly obtained higher cortisol values in the third measure (p=0.04) and the frailty load was significantly associated to the first measure (r=0.25, p=0.04). The simple linear regression analysis presented a determination rate (R2=0.05) between frailty load and first cortisol measure. Conclusion: The largest cortisol values in the morning and before sleeping among the frail elderly supply indications that can have a relationship of cortisol increase levels and the frailty presence in elderly from nursing homes.
Resumo:
Present day weather forecast models usually cannot provide realistic descriptions of local and particulary extreme weather conditions. However, for lead times of about a small number of days, they provide reliable forecast of the atmospheric circulation that encompasses the subscale processes leading to extremes. Hence, forecasts of extreme events can only be achieved through a combination of dynamical and statistical analysis methods, where a stable and significant statistical model based on prior physical reasoning establishes posterior statistical-dynamical model between the local extremes and the large scale circulation. Here we present the development and application of such a statistical model calibration on the besis of extreme value theory, in order to derive probabilistic forecast for extreme local temperature. The dowscaling applies to NCEP/NCAR re-analysis, in order to derive estimates of daily temperature at Brazilian northeastern region weather stations
Resumo:
The elaboration of this thesis aimed at getting to know the structure of the psychological well-being (PWB) at work and analysing the differences in the PWB levels among technical-administrative servants in public and private Institutions of Higher Education (IES) in the municipality of João Pessoa. Two hundred and thirty-three public and private IES male and female servants of João Pessoa participated in the research, replying to an instrument composed of questionnaires referring to the elaborated model. Factorial and regression analyses were accomplished in order to test the hypotheses in respect of the proposed model. The results showed that the PWB related with the work is composed of indicators such as affection, vitality, anxiety, depression, satisfaction at work and aspiration for accomplishment and reduction of the self-efficiency. The observed PWB predictors at work were the IES type, presence of children, age and the escape and back-out facing strategy. These predictors possess relationship of moderation among them in the explanation of PWB. On comparing the PWB experienced by the technical-administrative servants, it was observed that those linked to private IES showed higher PWB rates. Furthermore, there are differences among PWB predictors in accordance with the IES type. The applicability of the results of this thesis is wide as regards social interventions in the search of health improvement under a psycho-sociological perspective. Eventually, the thematic of this thesis intends to reinforce the studies on the worker s health, since by knowing what would lead him into a feeling of accomplishment and well-being will result in more chances of promoting him, while creating opportunities of a sounder life for these people in psychological terms
Resumo:
This dissertation aimed to analyze the perception of students about (EPW Health) Education Program at Work for Health Training in the area of Health. It discusses the proposed theme from the perception of students graduating from the EPW- Health courses participants (dentistry, medicine, physiotherapy, nursing, nutrition, physical education) who have developed their school activities in family health units in the city of João Pessoa between 2009/2011.The program aims policies curricular changes as a potential route of contributions to training in healthcare. Attention is drawn to the new possibilities of working health training contextualized, ethically grounded, socially endorsed. It is pointed out in this process the need to adapt to the demands of professional profiles of SUS (Sistema Único de Saúde). This is an exploratory, descriptive study within a qualitative approach, conducted in the city of João Pessoa in the context of health care courses at the Federal University of Paraiba. The empirical material of this study was treated by the use of technical analysis "Categorical Content Theme" by Bardin. The results indicate prospects for promoting new practices and curricular changes, which highlights the EPW- Health, which has been presenting important experiences in teaching -community -service- with the inclusion of students in the municipal health network. We conclude that the path from collection to data analysis, corroborated with the literature to reaffirm the importance and urgency of change in educational processes with a view to greater proximity to the health needs and the SUS. The EPW- Health project is incipient and requires further investigation in terms of effective interdisciplinary and multidisciplinary character of its proposal