980 resultados para overlapping community detection
Resumo:
We analyzed the structure of the understory community in the Atlantic Forest sensu lato, for which phytosociological descriptions of the understory are lacking. We delineated 50 plots of 10 × 20 m each at four sites within an Araucaria forest (a subtype of Atlantic Forest), located in the municipalities of Bananal, Campos do Jordão, Itaberá and Barra do Chapéu, all of which are in the state of São Paulo, Brazil. To sample the resident species of the understory, we randomly selected five 1 × 1 m subplots within each plot, resulting in a total sampling area of 250 m² at each site. We identified differences among the locations, mostly due to proportional differences in growth forms, in terms of species richness and the importance values within the community. Factors potentially influencing the understory structure include macroclimatic and microclimatic conditions, as well as forest fragmentation, the abundance of deciduous trees in the canopy, the surrounding vegetation and geographic location.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.
Resumo:
RATIONALE: Benign focal seizures of adolescence (BFSA) described by Loiseau et al in 1972, is considered a rare entity, but maybe underdiagnosed. Although mild neuropsychological deficits have been reported in patients with benign epilepsies of childhood, these evaluations have not so far been described in BFSA. The aim of this study is to evaluate neuropsychological functions in BFSA with new onset seizures (<12 months). METHODS: Eight patients with BFSA (according to Loiseau et al, 1972, focal or secondarily tonic clonic generalized seizures between the ages of 10-18 yrs., normal neurologic examination, normal EEG or with mild focal abnormalities) initiated in the last 12 months were studied between July 2008 to May 2009. They were referred from the Pediatric Emergency Section of the Hospital Universitário of the University of Sao Paulo, a secondary care regionalized facility located in a district of middle-low income in Sao Paulo city, Brazil. The study was approved by the Ethics Committee of the Institution. All patients performed neurological, EEG, brain CT and neuropsychological evaluation which consisted of Raven's Special Progressive Matrices - General and Special Scale (according to different ages), Wechsler Children Intelligence Scale-WISC III with ACID Profile, Trail Making Test A/B, Stroop Test, Bender Visuo-Motor Test, Rey Complex Figure, Rey Auditory Verbal Learning Test-RAVLT, Boston Naming Test, Fluency Verbal for phonological and also conceptual patterns - FAS/Animals and Hooper Visual Organization Test. For academic achievement, we used a Brazilian test for named "Teste do Desempenho Escolar", which evaluates abilities to read, write and calculate according to school grade. RESULTS: There were 2 boys and 6 girls, with ages ranging from 10 yrs. 9 m to 14 yrs. 3 m. Most (7/8) of the patients presented one to two seizures and only three of them received antiepileptic drugs (AEDs). Six had mild EEG focal abnormalities and all had normal brain CT. All were literate, attended regular public schools and scored in a median range for IQ, and seven showed discrete higher scores for the verbal subtests. There were low scores for attention in different modalities in six patients, mainly in alternated attention as well as inhibitory subtests (Stroop test and Trail Making Test part B). Four of the latter cases who showed impairment both in alternated and inhibitory attention were not taking AEDs. Visual memory was impaired in five patients (Rey Complex Figure). Executive functions analysis showed deficits in working memory in five, mostly observed in Digits Indirect Order and Arithmetic tests (WISC III). Reading and writing skills were below the expected average for school grade in six patients according to the achievement scholar performance test utilized. One patient of this series who had the best scores in all tests was taking phenobarbital. CONCLUSIONS: Neuropsychological imbalance between normal IQ and mild dysfunctions such as in attention domain and in some executive abilities like working memory and planning, as well as difficulties in visual memory and in reading and writing, were described in this group of patients with BFSA from community. This may reflect mild higher level neurological dysfunctions in adolescence idiopathic focal seizures probably caused by an underlying dysmaturative epileptogenic process. Although academic problems often have multiple causes, a specific educational approach may be necessary in these adolescents, in order to improve their scholastic achievements, helping in this way, to decrease the stigma associated to epileptic seizures in the community.
Resumo:
Secondary forests and exotic tree plantations are expanding across tropical landscapes. However, our current understanding of the value of these human-dominated forest landscapes for invertebrate biodiversity conservation is still very poor. In this paper, we use the leaf-litter ant fauna to assess invertebrate diversity in one commercially managed Eucalyptus plantation (four years old), two abandoned plantations of different regeneration ages (16 and 31 years), and one neighboring secondary Atlantic Forest in Southeastern Brazil. There was a clear gradient in species richness from the secondary forest to the managed Eucalyptus plantation; richness and diversity peaked in secondary forest and in the older regenerating Eucalyptus plantation. Significantly more species were recorded in secondary forest samples than in Eucalyptus plantations, but Eucalyptus plantations had a similar level of richness. Furthermore, a non-metric multidimensional scaling analysis revealed clear differences in species composition between the younger managed Eucalyptus plantation (understory absent) and habitats with sub-developed or developed understory. Eucalyptus plantations were characterized by an assemblage of widespread, generalist species very different from those known to occur in core forest habitats of southeastern Brazil. Our results indicate that while older regenerating Eucalyptus plantations can provide habitat to facilitate the persistence of generalist ant species, it is unlikely to conserve most of the primary forest species, such as specialized predators, Dacetini predators, and nomadic species.
Resumo:
The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.
Resumo:
Due to the imprecise nature of biological experiments, biological data is often characterized by the presence of redundant and noisy data. This may be due to errors that occurred during data collection, such as contaminations in laboratorial samples. It is the case of gene expression data, where the equipments and tools currently used frequently produce noisy biological data. Machine Learning algorithms have been successfully used in gene expression data analysis. Although many Machine Learning algorithms can deal with noise, detecting and removing noisy instances from the training data set can help the induction of the target hypothesis. This paper evaluates the use of distance-based pre-processing techniques for noise detection in gene expression data classification problems. This evaluation analyzes the effectiveness of the techniques investigated in removing noisy data, measured by the accuracy obtained by different Machine Learning classifiers over the pre-processed data.
Resumo:
The aim of this study was to determine how abiotic factors drive the phytoplankton community in a water supply reservoir within short sampling intervals. Samples were collected at the subsurface (0.1 m) and bottom of limnetic (8 m) and littoral (2 m) zones in both the dry and rainy seasons. The following abiotic variables were analyzed: water temperature, dissolved oxygen, electrical conductivity, total dissolved solids, turbidity, pH, total nitrogen, nitrite, nitrate, total phosphorus, total dissolved phosphorus and orthophosphate. Phytoplankton biomass was determined from biovolume values. The role abiotic variables play in the dynamics of phytoplankton species was determined by means of Canonical Correspondence Analysis. Algae biomass ranged from 1.17×10(4) to 9.21×10(4) µg.L-1; cyanobacteria had biomass values ranging from 1.07×10(4) to 8.21×10(4) µg.L-1. High availability of phosphorous, nitrogen limitation, alkaline pH and thermal stability all favored cyanobacteria blooms, particularly during the dry season. Temperature, pH, total phosphorous and turbidity were key factors in characterizing the phytoplankton community between sampling times and stations. Of the species studied, Cylindrospermopsis raciborskii populations were dominant in the phytoplankton in both the dry and rainy seasons. We conclude that the phytoplankton was strongly influenced by abiotic variables, particularly in relation to seasonal distribution patterns.
Development of instrumentation for amperometric and coulometric detection using ultramicroelectrodes
Resumo:
In this work it is presented the development of a simple, portable and inexpensive instrumentation for amperometric and coulometric detection in different analytical instrumentation systems utilizing ultramicroelectrodes. The software, developed in LabVIEW 7.1TM, is capable to carry out three main detection techniques (amperometric, pulsed amperometric and coulometric detection) and a voltammetric technique (cyclic voltammetry). The instrumentation was successfully evaluated using the following systems: cyclic voltammograms of metallic electrodes in alkaline solutions, flow electrochemical detection of glucose and glycine and direct determination of herbicide glyphosate (electrochemical detection coupled to HPLC).
Resumo:
This paper describes a sequential injection chromatography procedure for determination of picloram in waters exploring the low backpressure of a 2.5 cm long monolithic C18 column. Separation of the analyte from the matrix was achieved in less than 60 s using a mobile phase composed by 20:80 (v v-1) acetonitrile:5.0 mmol L-1 H3PO4 and flow rate of 30 μL s-1. Detection was made at 223 nm with a 40 mm optical path length cell. The limits of detection and quantification were 33 and 137 μg L-1, respectively. The proposed method is sensitive enough to monitor the maximum concentration level for picloram in drinking water (500 μg L-1). The sampling frequency is 60 analyses per hour, consuming only 300 μL of acetonitrile per analysis. The proposed methodology was applied to spiked river water samples and no statistically significant differences were observed in comparison to a conventional HPLC-UV method.
Resumo:
Concrete modules were deployed on the bottom of the 11, 18 and 30 meters isobaths along a cross-shelf hydrographic gradient off Paraná State, Southern Brazil, with the purpose of studying the colonization of sessile epilithic macroinvertebrates on artificial surfaces. After one year of submersion a total of 63 species of epilithic organisms were identified, dominated by Ostrea puelchana, Chthamalus bisinuatus, Balanus cf spongicola, Astrangia cf rathbuni, Didemnum spp, poryphers and bryozoans. Diversity index and percent cover at reef stations placed at 11, 18 and 30 meters isobaths were respectively 2.28 and 66.7%, 2.79 and 96.6% and 1.66 and 77.4%. Differences of general community structure among the three assemblages were not clearly related to the general environmental conditions at the bottom layers near the reef stations. Turbidity and larval abundance are discussed as important factors affecting colonization processes. Results indicate that depths between 15-20 meters are more suitable for the implementation of large scale artificial reef systems in the inner shelf off Paraná and, possibly, throughout the inner shelves off southern Brazil with similar hydrographic conditions.