995 resultados para Flying insects control
Resumo:
To characterize the recently described SCI1 (stigma/style cell cycle inhibitor 1) gene relationship with the auxin pathway, we have taken the advantage of the Arabidopsis model system and its available tools. At first, we have analyzed the At1g79200 T-DNA insertion mutants and constructed various transgenic plants. The loss- and gain-of-function plants displayed cell number alterations in upper pistils that were controlled by the amino-terminal domain of the protein. These data also confirmed that this locus holds the functional homolog (AtSCI1) of the Nicotiana tabacum SCI1 gene. Then, we have provided some evidences the auxin synthesis/signaling pathways are required for downstream proper AtSCI1 control of cell number: (a) its expression is downregulated in yuc2yuc6 and npy1 auxin-deficient mutants, (b) triple (yuc2yuc6sci1) and double (npy1sci1) mutants mimicked the auxin-deficient phenotypes, with no synergistic interactions, and (c) the increased upper pistil phenotype in these last mutants, which is a consequence of an increased cell number, was able to be complemented by AtSCI1 overexpression. Taken together, our data strongly suggests SCI1 as a component of the auxin signaling transduction pathway to control cell proliferation/differentiation in stigma/style, representing a molecular effector of this hormone on pistil development.
Resumo:
Up to 20% of women with hypertensive pregnancy disorders might persist with chronic hypertension. This study compared clinical and echocardiographic features between women whose hypertension began as hypertensive pregnancy disorders (PH group) and women whose diagnosis of hypertension did not occur during pregnancy (NPH group). Fifty PH and 100 NPH women were cross-sectionally evaluated by clinical, laboratory, and echocardiography analysis, and the groups were matched by duration of hypertension. PH exhibited lower age (46.6 ± 1.4 vs. 65.3 ± 1.1 years; P < .001), but higher systolic (159.8 ± 3.9 vs. 148.0 ± 2.5 mm Hg; P = .009) and diastolic (97.1 ± 2.4 vs. 80.9 ± 1.3 mm Hg; P < .001) blood pressure than NPH, although used more antihypertensive classes (3.4 ± 0.2 vs. 2.6 ± 0.1; P < .001). Furthermore, PH showed higher left ventricular wall thickness and increased prevalence of concentric hypertrophy than NPH after adjusting for age and blood pressure. In conclusion, this study showed that PH may exhibit worse blood pressure control and adverse left ventricular remodeling compared with NPH.
Resumo:
The role of key cell cycle regulation genes such as, CDKN1B, CDKN2A, CDKN2B, and CDKN2C in sporadic medullary thyroid carcinoma (s-MTC) is still largely unknown. In order to evaluate the influence of inherited polymorphisms of these genes on the pathogenesis of s-MTC, we used TaqMan SNP genotyping to examine 45 s-MTC patients carefully matched with 98 controls. A multivariate logistic regression analysis demonstrated that CDKN1B and CDKN2A genes were related to s-MTC susceptibility. The rs2066827*GT+GG CDKN1B genotype was more frequent in s-MTC patients (62.22%) than in controls (40.21%), increasing the susceptibility to s-MTC (OR=2.47; 95% CI=1.048-5.833; P=0.038). By contrast, the rs11515*CG+GG of CDKN2A gene was more frequent in the controls (32.65%) than in patients (15.56%), reducing the risk for s-MTC (OR=0.174; 95% CI=0.048-0.627; P=0.0075). A stepwise regression analysis indicated that two genotypes together could explain 11% of the total s-MTC risk. In addition, a relationship was found between disease progression and the presence of alterations in the CDKN1A (rs1801270), CDKN2C (rs12885), and CDKN2B (rs1063192) genes. WT rs1801270 CDKN1A patients presented extrathyroidal tumor extension more frequently (92%) than polymorphic CDKN1A rs1801270 patients (50%; P=0.0376). Patients with the WT CDKN2C gene (rs12885) presented larger tumors (2.9±1.8 cm) than polymorphic patients (1.5±0.7 cm; P=0.0324). On the other hand, patients with the polymorphic CDKN2B gene (rs1063192) presented distant metastases (36.3%; P=0.0261). In summary, we demonstrated that CDKN1B and CDKN2A genes are associated with susceptibility, whereas the inherited genetic profile of CDKN1A, CDKN2B, and CDKN2C is associated with aggressive features of tumors. This study suggests that profiling cell cycle genes may help define the risk and characterize s-MTC aggressiveness.
Resumo:
Trypsins and chymotrypsins are well-studied serine peptidases that cleave peptide bonds at the carboxyl side of basic and hydrophobic l-amino acids, respectively. These enzymes are largely responsible for the digestion of proteins. Three primary processes regulate the activity of these peptidases: secretion, precursor (zymogen) activation and substrate-binding site recognition. Here, we present a detailed phylogenetic analysis of trypsins and chymotrypsins in three orders of holometabolous insects and reveal divergent characteristics of Lepidoptera enzymes in comparison with those of Coleoptera and Diptera. In particular, trypsin subsite S1 was more hydrophilic in Lepidoptera than in Coleoptera and Diptera, whereas subsites S2-S4 were more hydrophobic, suggesting different substrate preferences. Furthermore, Lepidoptera displayed a lineage-specific trypsin group belonging only to the Noctuidae family. Evidence for facilitated trypsin auto-activation events were also observed in all the insect orders studied, with the characteristic zymogen activation motif complementary to the trypsin active site. In contrast, insect chymotrypsins did not seem to have a peculiar evolutionary history with respect to their mammal counterparts. Overall, our findings suggest that the need for fast digestion allowed holometabolous insects to evolve divergent groups of peptidases with high auto-activation rates, and highlight that the evolution of trypsins led to a most diverse group of enzymes in Lepidoptera.
Resumo:
The formation of mono-species biofilm (Listeria monocytogenes) and multi-species biofilms (Enterococcus faecium, Enterococcus faecalis, and L. monocytogenes) was evaluated. In addition, the effectiveness of sanitation procedures for the control of the multi-species biofilm also was evaluated. The biofilms were grown on stainless steel coupons at various incubation temperatures (7, 25 and 39°C) and contact times (0, 1, 2, 4, 6 and 8days). In all tests, at 7°C, the microbial counts were below 0.4 log CFU/cm(2) and not characteristic of biofilms. In mono-species biofilm, the counts of L. monocytogenes after 8days of contact were 4.1 and 2.8 log CFU/cm(2) at 25 and 39°C, respectively. In the multi-species biofilms, Enterococcus spp. were present at counts of 8 log CFU/cm(2) at 25 and 39°C after 8days of contact. However, the L. monocytogenes in multi-species biofilms was significantly affected by the presence of Enterococcus spp. and by temperature. At 25°C, the growth of L. monocytogenes biofilms was favored in multi-species cultures, with counts above 6 log CFU/cm(2) after 8days of contact. In contrast, at 39°C, a negative effect was observed for L. monocytogenes biofilm growth in mixed cultures, with a significant reduction in counts over time and values below 0.4 log CFU/cm(2) starting at day 4. Anionic tensioactive cleaning complemented with another procedure (acid cleaning, disinfection or acid cleaning+disinfection) eliminated the multi-species biofilms under all conditions tested (counts of all micro-organisms<0.4 log CFU/cm(2)). Peracetic acid was the most effective disinfectant, eliminating the multi-species biofilms under all tested conditions (counts of the all microorganisms <0.4 log CFU/cm(2)). In contrast, biguanide was the least effective disinfectant, failing to eliminate biofilms under all the test conditions.
Resumo:
The biofilm formation of Enterococcus faecalis and Enterococcus faecium isolated from the processing of ricotta on stainless steel coupons was evaluated, and the effect of cleaning and sanitization procedures in the control of these biofilms was determined. The formation of biofilms was observed while varying the incubation temperature (7, 25 and 39°C) and time (0, 1, 2, 4, 6 and 8days). At 7°C, the counts of E. faecalis and E. faecium were below 2log10CFU/cm(2). For the temperatures of 25 and 39°C, after 1day, the counts of E. faecalis and E. faecium were 5.75 and 6.07log10CFU/cm(2), respectively, which is characteristic of biofilm formation. The tested sanitation procedures a) acid-anionic tensioactive cleaning, b) anionic tensioactive cleaning+sanitizer and c) acid-anionic tensioactive cleaning+sanitizer were effective in removing the biofilms, reducing the counts to levels below 0.4log10CFU/cm(2). The sanitizer biguanide was the least effective, and peracetic acid was the most effective. These studies revealed the ability of enterococci to form biofilms and the importance of the cleaning step and the type of sanitizer used in sanitation processes for the effective removal of biofilms.
Resumo:
Objective Patients with mesial temporal lobe epilepsy (MTLE) may present unstable pattern of seizures. We aimed to evaluate the occurrence of relapse-remitting seizures in MTLE with (MTLE-HS) and without (MTLE-NL) hippocampal sclerosis. Method We evaluated 172 patients with MTLE-HS (122) or MTLE-NL (50). Relapse-remitting pattern was defined as periods longer than two years of seizure-freedom intercalated with seizure recurrence. Infrequent seizures was considered as up to three seizures per year and frequent seizures as any period of seizures higher than that. Results Thirty-seven (30%) MTLE-HS and 18 (36%) MTLE-NL patients had relapse-remitting pattern (X2, p = 0.470). This was more common in those with infrequent seizures (X2, p < 0.001). Twelve MTLE-HS and one MTLE-NL patients had prolonged seizure remission between the first and second decade of life (X2, p = 0.06). Conclusion Similar proportion of MTLE-HS or MTLE-NL patients present relapse-remitting seizures and this occurs more often in those with infrequent seizures.
Resumo:
The aim of this study was to analyze the prevalence of hypertension and control practices among the elderly. The survey analyzed data from 872 elderly people in São Paulo, Brazil, through a cluster sampling, stratified according to education and income. A Poisson multiple regression model checked for the existence of factors associated with hypertension. The prevalence of self-reported hypertension among the elderly was 46.9%. Variables associated with hypertension were self-rated health, alcohol consumption, gender, and hospitalization in the last year, regardless of age. The three most common measures taken to control hypertension, but only rarely, are oral medication, routine salt-free diet and physical activity. Lifestyle and socioeconomic status did not affect the practice of control, but knowledge about the importance of physical activity was higher among those older people with higher education and greater income. The research suggests that health policies that focus on primary care to encourage lifestyle changes among the elderly are necessary.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Dental erosion is a type of wear caused by non bacterial acids or chelation. There is evidence of a significant increase in the prevalence of dental wear in the deciduous and permanent teeth as a consequence of the frequent intake of acidic foods and drinks, or due to gastric acid which may reach the oral cavity following reflux or vomiting episodes. The presence of acids is a prerequisite for dental erosion, but the erosive wear is complex and depends on the interaction of biological, chemical and behavioral factors. Even though erosion may be defined or described as an isolated process, in clinical situations other wear phenomena are expected to occur concomitantly, such as abrasive wear (which occurs, e.g, due to tooth brushing or mastication). In order to control dental loss due to erosive wear it is crucial to take into account its multifactorial nature, which predisposes some individuals to the condition.
Resumo:
The mechanical control of supragingival biofilm is accepted as one of the most important measures to treat and prevent dental caries and periodontal diseases. Nevertheless, maintaining dental surfaces biofilm-free is not an easy task. In this regard, chemical agents, mainly in the form of mouthwashes, have been studied to help overcome the difficulties involved in the mechanical control of biofilm. The aim of this paper was to discuss proposals for the teaching of supragingival chemical control (SCC) in order to improve dentists' knowledge regarding this clinical issue. Firstly, the literature regarding the efficacy of antiseptics is presented, clearly showing that chemical agents are clinically effective in the reduction of biofilm and gingival inflammation when used as adjuvant agents to mechanical control. Thus, it is suggested that the content related to SCC be included in the curricular grid of dental schools. Secondly, some essential topics are recommended to be included in the teaching of SCC as follows: skills and competencies expected of a graduate dentist regarding SCC; how to include this content in the curricular grid; teaching-learning tools and techniques to be employed; and program content.
Resumo:
The arterial partial pressure (P CO2) of carbon dioxide is virtually constant because of the close match between the metabolic production of this gas and its excretion via breathing. Blood gas homeostasis does not rely solely on changes in lung ventilation, but also to a considerable extent on circulatory adjustments that regulate the transport of CO2 from its sites of production to the lungs. The neural mechanisms that coordinate circulatory and ventilatory changes to achieve blood gas homeostasis are the subject of this review. Emphasis will be placed on the control of sympathetic outflow by central chemoreceptors. High levels of CO2 exert an excitatory effect on sympathetic outflow that is mediated by specialized chemoreceptors such as the neurons located in the retrotrapezoid region. In addition, high CO2 causes an aversive awareness in conscious animals, activating wake-promoting pathways such as the noradrenergic neurons. These neuronal groups, which may also be directly activated by brain acidification, have projections that contribute to the CO2-induced rise in breathing and sympathetic outflow. However, since the level of activity of the retrotrapezoid nucleus is regulated by converging inputs from wake-promoting systems, behavior-specific inputs from higher centers and by chemical drive, the main focus of the present manuscript is to review the contribution of central chemoreceptors to the control of autonomic and respiratory mechanisms.
Resumo:
OBJECTIVE: Despite the relevance of irritability emotions to the treatment, prognosis and classification of psychiatric disorders, the neurobiological basis of this emotional state has been rarely investigated to date. We assessed the brain circuitry underlying personal script-driven irritability in healthy subjects (n = 11) using functional magnetic resonance imaging. METHOD: Blood oxygen level-dependent signal changes were recorded during auditory presentation of personal scripts of irritability in contrast to scripts of happiness or neutral emotional content. Self-rated emotional measurements and skin conductance recordings were also obtained. Images were acquired using a 1,5T magnetic resonance scanner. Brain activation maps were constructed from individual images, and between-condition differences in the mean power of experimental response were identified by using cluster-wise nonparametric tests. RESULTS: Compared to neutral scripts, increased blood oxygen level-dependent signal during irritability scripts was detected in the left subgenual anterior cingulate cortex, and in the left medial, anterolateral and posterolateral dorsal prefrontal cortex (cluster-wise p-value < 0.05). While the involvement of the subgenual cingulate and dorsal anterolateral prefrontal cortices was unique to the irritability state, increased blood oxygen level-dependent signal in dorsomedial and dorsal posterolateral prefrontal regions were also present during happiness induction. CONCLUSION: Irritability induction is associated with functional changes in a limited set of brain regions previously implicated in the mediation of emotional states. Changes in prefrontal and cingulate areas may be related to effortful cognitive control aspects that gain salience during the emergence of irritability.
Resumo:
OBJECTIVE: Because autonomic dysfunction has been found to lead to cardiometabolic disorders and because studies have reported that simvastatin treatment has neuroprotective effects, the objective of the present study was to investigate the effects of simvastatin treatment on cardiovascular and autonomic changes in fructose-fed female rats. METHODS: Female Wistar rats were divided into three groups: controls (n=8), fructose (n=8), and fructose+ simvastatin (n=8). Fructose overload was induced by supplementing the drinking water with fructose (100 mg/L, 18 wks). Simvastatin treatment (5 mg/kg/day for 2 wks) was performed by gavage. The arterial pressure was recorded using a data acquisition system. Autonomic control was evaluated by pharmacological blockade. RESULTS: Fructose overload induced an increase in the fasting blood glucose and triglyceride levels and insulin resistance. The constant rate of glucose disappearance during the insulin intolerance test was reduced in the fructose group (3.4+ 0.32%/min) relative to that in the control group (4.4+ 0.29%/min). Fructose+simvastatin rats exhibited increased insulin sensitivity (5.4+0.66%/min). The fructose and fructose+simvastatin groups demonstrated an increase in the mean arterial pressure compared with controls rats (fructose: 124+2 mmHg and fructose+simvastatin: 126 + 3 mmHg vs. controls: 112 + 2 mmHg). The sympathetic effect was enhanced in the fructose group (73 + 7 bpm) compared with that in the control (48 + 7 bpm) and fructose+simvastatin groups (31+8 bpm). The vagal effect was increased in fructose+simvastatin animals (84 + 7 bpm) compared with that in control (49 + 9 bpm) and fructose animals (46+5 bpm). CONCLUSION: Simvastatin treatment improved insulin sensitivity and cardiac autonomic control in an experimental model of metabolic syndrome in female rats. These effects were independent of the improvements in the classical plasma lipid profile and of reductions in arterial pressure. These results support the hypothesis that statins reduce the cardiometabolic risk in females with metabolic syndrome.
Resumo:
Leukemia incidence in children has increased worldwide in recent decades, particularly due to the rise in acute lymphoblastic leukemia. Studies have associated exposure to non-ionizing radiation generated by low frequency magnetic fields with childhood leukemia. The current article reviews the case-control studies published on this subject. Of 152 articles tracked in different databases, ten studies from North America, Asia, and Europe met the defined selection criteria, with patients diagnosed from 1960 to 2004. Methodological limitations were observed in these articles, including difficulties with the procedures for assessing exposure. An association may exist between exposure to low frequency magnetic fields and acute lymphoblastic leukemia in children, but this association is weak, preventing the observation of consistency in the findings. Future studies from a wider range of geographic regions should focus on the analysis of acute lymphoblastic leukemia, which is the subtype with the greatest impact on the increasing overall incidence of childhood leukemia.