994 resultados para soil-tool adhesion
Resumo:
Quantifying global patterns of terrestrial nitrogen (N) cycling is central to predicting future patterns of primary productivity, carbon sequestration, nutrient fluxes to aquatic systems, and climate forcing. With limited direct measures of soil N cycling at the global scale, syntheses of the (15)N:(14)N ratio of soil organic matter across climate gradients provide key insights into understanding global patterns of N cycling. In synthesizing data from over 6000 soil samples, we show strong global relationships among soil N isotopes, mean annual temperature (MAT), mean annual precipitation (MAP), and the concentrations of organic carbon and clay in soil. In both hot ecosystems and dry ecosystems, soil organic matter was more enriched in (15)N than in corresponding cold ecosystems or wet ecosystems. Below a MAT of 9.8°C, soil δ(15)N was invariant with MAT. At the global scale, soil organic C concentrations also declined with increasing MAT and decreasing MAP. After standardizing for variation among mineral soils in soil C and clay concentrations, soil δ(15)N showed no consistent trends across global climate and latitudinal gradients. Our analyses could place new constraints on interpretations of patterns of ecosystem N cycling and global budgets of gaseous N loss.
Mineral Nutrition Of Campos Rupestres Plant Species On Contrasting Nutrient-impoverished Soil Types.
Resumo:
In Brazil, the campos rupestres occur over the Brazilian shield, and are characterized by acidic nutrient-impoverished soils, which are particularly low in phosphorus (P). Despite recognition of the campos rupestres as a global biodiversity hotspot, little is known about the diversity of P-acquisition strategies and other aspects of plant mineral nutrition in this region. To explore nutrient-acquisition strategies and assess aspects of plant P nutrition, we measured leaf P and nitrogen (N) concentrations, characterized root morphology and determined the percentage arbuscular mycorrhizal (AM) colonization of 50 dominant species in six communities, representing a gradient of soil P availability. Leaf manganese (Mn) concentration was measured as a proxy for carboxylate-releasing strategies. Communities on the most P-impoverished soils had the highest proportion of nonmycorrhizal (NM) species, the lowest percentage of mycorrhizal colonization, and the greatest diversity of root specializations. The large spectrum of leaf P concentration and variation in root morphologies show high functional diversity for nutritional strategies. Higher leaf Mn concentrations were observed in NM compared with AM species, indicating that carboxylate-releasing P-mobilizing strategies are likely to be present in NM species. The soils of the campos rupestres are similar to the most P-impoverished soils in the world. The prevalence of NM strategies indicates a strong global functional convergence in plant mineral nutrition strategies among severely P-impoverished ecosystems.
Resumo:
The research approaches recycling of urban waste compost (UWC) as an alternative fertilizer for sugarcane crop and as a social and environmental solution to the solids residuals growth in urban centers. A mathematical model was used in order to know the metal dynamics as decision support tool, aiming to establish of criteria and procedures for UWC's safe use, limited by the amount of heavy metal. A compartmental model was developed from experimental data in controlled conditions and partially checked with field data. This model described the heavy metal transference in the system soil-root-aerial portion of sugarcane plants and concluded that nickel was metal to be concern, since it takes approximately three years to be attenuated in the soil, reaching the aerial portions of the plant at high concentrations. Regarding factors such as clay content, oxide level and soil pH, it was observed that for soil with higher buffering capacity, the transfer of the majority of the metals was slower. This model may become an important tool for the attainment of laws regarding the UWC use, aiming to reduce environment contamination the waste accumulation and production costs.
Resumo:
This paper describes the development of a relational database and a tool for viewing MODIS NDVI temporal profile, using data from MOD09Q1 product, specifically the surface bidirectional reflectance factor relative to the RED and NIR wavelength, mosaic of 8-day temporal composition, and the quality band, in sugarcane fields in the state of São Paulo, for analysis of the late stubble-cane maturation. From sugarcane farms were obtained the historical data about yield, soil, variety, location of the each pixel for each subregion monitored. All data were integrated in a database developed in PostgreSQL. The tool was implemented using Java language and allowed a fast and automatic way of analyzing sugarcane phenological patterns. It concluded that the MODIS NDVI temporal profile using data from MOD09Q1 product is able to subsidize the monitoring of phenological changes in the sugarcane.
Resumo:
The main purpose of this work was to study the germination of Ternstroemia brasiliensis seeds both in laboratory and field conditions in order to contribute to understanding the regeneration ecology of the species. The seeds were dispersed with relatively high moisture content and exhibit a recalcitrant storage behaviour because of their sensitivity to dehydration and to dry storage. The germinability is relatively high and is not affected either by light or aril presence. The absence of the dormancy and the low sensitivity to far red light can enable to seeds to promptly germinate under Restinga forest canopy, not forming a soil seed bank. The constant temperatures of 25 ºC and 30 ºC were considered optimum for germination of T. brasiliensis seeds. Temperature germination parameters can be affected by light conditions. The thermal-time model can be a suitable tool for investigating the temperature dependence on the seed germination of T. brasiliensis. The germination characteristics de T. brasiliensis are typical of non pioneer species, and help to explain the distribution of the species. Germination of T. brasiliensis seeds in Restinga environment may be not limited by light and temperature; otherwise the soil moisture content can affect the seed germination.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
This study evaluated comparatively the adhesion of Epiphany and AH Plus endodontic sealers to human root dentin treated with 1% NaOCl and 1% NaOCl+17% EDTA, using the push-out test. Sixty root cylinders obtained from maxillary canines had the canals prepared and were randomly assigned to 3 groups (n=20), according to root dentin treatment: GI - distilled water (control), GII - 1% NaOCl and GIII - 1% NaOCl+17% EDTA. Each group was divided into 2 subgroups (n=10) filled with either Epiphany or AH Plus. Bond strength push-out test data (kN) were obtained and analyzed statistically by ANOVA and Tukey's post-hoc test. There was statistically significant difference between sealers (AH Plus: 0.78 ± 0.13; Epiphany: 0.61 ± 0.19; p<0.01) and among root dentin treatments (distilled water: 0.58 ± 0.19; 1% NaOCl: 0.71 ± 0.12; 1% NaOCl+17% EDTA: 0.80 ± 0.17; p<0.05). In conclusion, AH Plus sealer presented greater adhesion to dentin than Epiphany, regardless of the treatment of root canal walls.
Resumo:
OBJECTIVE: This study evaluated in vitro the influence of an eugenol-based sealer (EndoFill) on the retention of stainless steel prefabricated posts cemented with zinc phosphate and resin-based (Panavia F) cements after different periods of root canal obturation, using the pull-out test. MATERIAL AND METHODS: Sixty upper canines were decoronated and the roots were embedded in resin blocks. The specimens were distributed into 3 groups, according to the period elapsed between canal obturation and post cementation: Group I - immediately; Group II - 72 h and Group III - 4 months. The groups were subdivided according to the type of cement used for post cementation: A - zinc phosphate and B - Panavia F. Following the experimental periods, specimens were subjected to pullout test in an Instron machine with application of tensile force at a crosshead speed of 0.5 mm/min until post dislodgement. The maximum forces required for post removal were recorded (kN) and means were subjected to statistical analysis by 2-way ANOVA and Tukey-Kramer test (α=0.001) RESULTS: There were statistically significant differences (p<0.01) between the posts cemented with zinc phosphate cement (0.2112 kN) and Panavia F (0.0501 kN). However, no statistically significant differences (p>0.05) were found between the three post cementation periods, regardless of the cement. CONCLUSIONS: It was concluded that the eugenol-based sealer influenced the tensile strength of the posts cemented with the resin cement, but had no influence on the time waited between root canal obturation and post space preparation/post cementation.
Resumo:
The use of an adequate method for evaluation of the adhesion of root canal filling materials provides more reliable results to allow comparison of the materials and substantiate their clinical choice. The aims of this study were to compare the shear bond strength (SBS) test and push-out test for evaluation of the adhesion of an epoxy-based endodontic sealer (AH Plus) to dentin and gutta-percha, and to assess the failure modes on the debonded surfaces by means of scanning electron microscopy (SEM). Three groups were established (n=7): in group 1, root cylinders obtained from human canines were embedded in acrylic resin and had their canals prepared and filled with sealer; in group 2, longitudinal sections of dentin cylinders were embedded in resin with the canal surface smoothed and turned upwards; in group 3, gutta-percha cylinders were embedded in resin. Polyethylene tubes filled with sealer were positioned on the polished surface of the specimens (groups 2 and 3). The push-out test (group 1) and the SBS test (groups 2 and 3) were performed in an Instron universal testing machine running at crosshead speed of 1 mm/min. Means (±SD) in MPa were: G1 (8.8±1.13), G2 (5.9±1.05) and G3 (3.8±0.55). Statistical analysis by ANOVA and Student's t-test (a=0.05) revealed statistically significant differences (p<0.01) among the groups. SEM analysis showed a predominance of adhesive and mixed failures of AH Plus sealer. The tested surface affected significantly the results with the sealer reaching higher bond strength to dentin than to gutta-percha with the SBS test. The comparison of the employed methodologies showed that the SBS test produced significantly lower bond strength values than the push-out test, was skilful in determining the adhesion of AH Plus sealer to dentin and gutta-percha, and required specimens that could be easily prepared for SEM, presenting as a viable alternative for further experiments.
Resumo:
Application of calcium silicate (SiCa) as soil acidity corrective was evaluated in a Rhodic Hapludox soil with palisade grass conducted under pasture rotation system with different grazing intensities. Experimental design was complete randomized blocks with four grazing intensities - grazing intensities were imposed by forage supply (50, 100, 150 and 200 kg t-1 of DM per LW) - in experimental plots with four replicates and, in the subplots, with seven doses of calcium silicate combined with lime: 0+0, 2+0, 4+0, 6+0, 2+4, 4+2 and 0+6 t ha-1, respectively. In the soil, it was evaluated the effect of four levels of calcium silicate (0, 2, 4 and 6 t ha-1) at 45, 90, and 365 days at three depths (0-10, 10-20 and 20-40 cm) and at 365 days, it was included one level of lime (6 t ha-1). For determination of leaf chemical composition and silicate content in the soil, four levels of calcium silicate (0, 2, 4 and 6 t ha-1) were evaluated at 45 and 365 days and at 45 days only for leaf silicate, whereas for dry matter production, all corrective treatments applied were evaluated in evaluation seasons. Application of calcium silicate was positive for soil chemical traits related to acidity correction (pH(CaCl2), Ca, Mg, K, H+Al and V), but the limestone promoted better results at 365 days. Leaf mineral contents were not influenced by application of calcium silicate, but there was an increase on silicate contents in leaves and in the soil. Dry matter yield and chemical composition of palisade grass improved with the application of correctives.
Resumo:
Gaseous N losses from soil are considerable, resulting mostly from ammonia volatilization linked to agricultural activities such as pasture fertilization. The use of simple and accessible measurement methods of such losses is fundamental in the evaluation of the N cycle in agricultural systems. The purpose of this study was to evaluate quantification methods of NH3 volatilization from fertilized surface soil with urea, with minimal influence on the volatilization processes. The greenhouse experiment was arranged in a completely randomized design with 13 treatments and five replications, with the following treatments: (1) Polyurethane foam (density 20 kg m-3) with phosphoric acid solution absorber (foam absorber), installed 1, 5, 10 and 20 cm above the soil surface; (2) Paper filter with sulfuric acid solution absorber (paper absorber, 1, 5, 10 and 20 cm above the soil surface); (3) Sulfuric acid solution absorber (1, 5 and 10 cm above the soil surface); (4) Semi-open static collector; (5) 15N balance (control). The foam absorber placed 1 cm above the soil surface estimated the real daily rate of loss and accumulated loss of NH3N and proved efficient in capturing NH3 volatized from urea-treated soil. The estimates based on acid absorbers 1, 5 and 10 cm above the soil surface and paper absorbers 1 and 5 cm above the soil surface were only realistic for accumulated N-NH3 losses. Foam absorbers can be indicated to quantify accumulated and daily rates of NH3 volatilization losses similarly to an open static chamber, making calibration equations or correction factors unnecessary.
Resumo:
Ferruginous "campos rupestres" are a particular type of vegetation growing on iron-rich primary soils. We investigated the influence of soil properties on plant species abundance at two sites of ferruginous "campos rupestres" and one site of quartzitic "campo rupestre", all of them in "Quadrilátero Ferrífero", in Minas Gerais State, southeastern Brazil. In each site, 30 quadrats were sampled to assess plant species composition and abundance, and soil samples were taken to perform chemical and physical analyses. The analyzed soils are strongly acidic and presented low fertility and high levels of metallic cations; a principal component analysis of soil data showed a clear segregation among sites due mainly to fertility and heavy metals content, especially Cu, Zn, and Pb. The canonical correspondence analysis indicated a strong correlation between plant species abundance and soil properties, also segregating the sites.
Resumo:
The mineralogical characterization through mineral quantification of Brazilian soils by X-ray diffraction data using the Rietveld Method is not common. A mineralogical quantification of an Acric Ferralsol from the Ponta Grossa region, state of Paraná, Brazil, was carried out using this Method with X-Ray Diffraction data to verify if this method was suitable for mineral quantification of a highly-weathered soil. The A, AB and B3 horizons were fractioned to separate the different particle sizes: clay, silt, fine sand (by Stokes Law) and coarse sand fractions (by sieving), with the procedure free of chemical treatments. X-ray Fluorescence, Inductively Coupled Plasma Atomic Emission Spectrometry, Infrared Spectroscopy and Mössbauer Spectroscopy were used in order to assist the mineral identification and quantification. The Rietveld Method enabled the quantification of the present minerals. In a general way, the quantitative mineralogical characterization by the Rietveld Method revealed that quartz, gibbsite, rutile, hematite, goethite, kaolinite and halloysite were present in the clay and silt fractions of all horizons. The silt fractions of the deeper horizons were different from the more superficial ones due to the presence of large amounts of quartz. The fine and the coarse sand fractions are constituted mainly by quartz. Therefore, a mineralogical quantification of the finer fraction (clay and silt) by the Rietveld Method was successful.
Resumo:
The potential of charcoal and of partially combusted organic waste to mimic the soil organic matter of the Terras Pretas de Índios (Amazonian Dark Earths) from the Amazon Region is discussed. These materials serve as soil conditioners and as sequesterers of carbon in recalcitrant and in reactive forms. Studies carried out by Brazilian and by international groups have contributed to the emergence of an awareness of the compositions and of the uses of these materials. In this contribution we report on chemical studies that are leading to the development of a scientific and technological awareness, and of innovations that will have value in finding novel uses in applications to soil of chars from organic wastes such as those from the biofuel industry, and from metallurgical and various coal plant residues.
Resumo:
Absolute dating methods have been used in chronological studies of geological processes and sedimentary units of Quaternary age in Central Amazonia, Brazil. Although radiocarbon dating has been very useful in archaeological research and soil studies, the temporal interval of this method is inefficient in evaluating the sedimentation aspects and geological events from the beginning of the Quaternary in the Amazon basin. The use of crystal luminescence dating has been one of the most promising tool for determining the absolute dating of Quaternary deposits in the Amazonian region. Optically stimulated luminescence (OSL) dating, following the MAR and SAR protocols, in a tectonic-sedimentary study of Quaternary fluvial deposits in the confluence area of the Negro and Solimões rivers, indicated ages from 1.3 (Holocene) to about 67.4 kyears (Late Pleistocene) for these sediments. Low radioactive isotope concentrations were found about 2ppm for 235U and 238U; 5ppm for 232Th; and the 40K concentrations were almost zero. A comparison was made between MAR and SAR protocols taking into account the fluvial depositional process.