Cartas de controle para gerenciamento de operações agrícolas mecanizadas

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Sistema de conversão de energia eólica baseado no gerador de indução duplamente alimentado: análise e contribuição ao controle da máquina

The humanity reached a time of unprecedented technological development. Science has achieved and continues to achieve technologies that allowed increasingly to understand the universe and the laws which govern it, and also try to coexist without destroying the planet we live on. One of the main challenges of the XXI century is to seek and increase new sources of clean energy, renewable and able to sustain our growth and lifestyle. It is the duty of every researcher engage and contribute in this race of energy. In this context, wind power presents itself as one of the great promises for the future of electricity generation . Despite being a bit older than other sources of renewable energy, wind power still presents a wide field for improvement. The development of new techniques for control of the generator along with the development of research laboratories specializing in wind generation are one of the key points to improve the performance, efficiency and reliability of the system. Appropriate control of back-to-back converter scheme allows wind turbines based on the doubly-fed induction generator to operate in the variable-speed mode, whose benefits include maximum power extraction, reactive power injection and mechanical stress reduction. The generator-side converter provides control of active and reactive power injected into the grid, whereas the grid-side converter provides control of the DC link voltage and bi-directional power flow. The conventional control structure uses PI controllers with feed-forward compensation of cross-coupling dq terms. This control technique is sensitive to model uncertainties and the compensation of dynamic dq terms results on a competing control strategy. Therefore, to overcome these problems, it is proposed in this thesis a robust internal model based state-feedback control structure in order to eliminate the cross-coupling terms and thereby improve the generator drive as well as its dynamic behavior during sudden changes in wind speed. It is compared the conventional control approach with the proposed control technique for DFIG wind turbine control under both steady and gust wind conditions. Moreover, it is also proposed in this thesis an wind turbine emulator, which was developed to recreate in laboratory a realistic condition and to submit the generator to several wind speed conditions.

Estabilização de órbitas periódicas instáveis utilizando controle por modos deslizantes com compensação adaptativa

The chaotic behavior has been widely observed in nature, from physical and chemical phenomena to biological systems, present in many engineering applications and found in both simple mechanical oscillators and advanced communication systems. With regard to mechanical systems, the effects of nonlinearities on the dynamic behavior of the system are often of undesirable character, which has motivated the development of compensation strategies. However, it has been recently found that there are situations in which the richness of nonlinear dynamics becomes attractive. Due to their parametric sensitivity, chaotic systems can suffer considerable changes by small variations on the value of their parameters, which is extremely favorable when we want to give greater flexibility to the controlled system. Hence, we analyze in this work the parametric sensitivity of Duffing oscillator, in particular its unstable periodic orbits and Poincar´e section due to changes in nominal value of the parameter that multiplies the cubic term. Since the amount of energy needed to stabilize Unstable Periodic Orbits is minimum, we analyze the control action needed to control and stabilize such orbits which belong to different versions of the Duffing oscillator. For that we will use a smoothed sliding mode controller with an adaptive compensation term based on Fourier series.

Regulador eletromagnético de frequência aplicado no controle de velocidade de geradores eólicos

The constant necessity for new sources of renewable energy is increasingly promoting the increase of investments in this area. Among other sources, the wind power has been becoming prominent. It is important to promote the search for the improvement of the technologies involved in the topologies of the wind turbines, seeking for alternatives which enhance the gotten performance, despite the irregularity of the wind speed. This study presents a new system for speed control, in this case applied to the wind turbines - the Electromagnetic Frequency Regulator (EFR). One of the most used devices in some topologies is the mechanical gearboxes which, along with a short service life, often represent sources of noise and defects. The EFR does not need these transmission boxes, representing a technological advancement, using for that an adapted induction machine, in which the stator becomes mobile, supportive to the axis of the turbine. In the topology used in this study, the EFR also allows us to leave out the usage of the eletronic converters to establish the coupling between the generator and the electrical grid. It also the reason why it provides the possibility of obtaining the generation in alternating current, with constant voltage and frequency, where there is no electrical grid. Responsable for the mechanical speed control of the generator, the EFR can be useful in other transmission systems in which the mechanical speed control output is the objective. In addition, the EFR operates through the combination of two inputs, a mechanical and other electrical. It multiplies the possibilities of application because it is able to synergistic coupling between different arrays of energy, and, for such reasons, it enables the various sources of energy involved to be uncoupled from the network, being the synchronous generator responsible for the system connection with the electrical grid, simplifying the control strategies on the power injected in it. Experimental and simulation results are presented through this study, about a wind turbine, validating the proposal related to the efficience in the speed control of the system for different wind conditions.

Eficácia do florfenicol e da oxitetraciclina no controle de Aeromonas hydrophila em pacu (Piaractus mesopotamicus)

Determinou-se a concentração eficaz de oxitetraciclina (OTC) e florfenicol (FFC) no tratamento de Aeromonas hydrophila em pacu (Piaractus. mesopotamicus). Os pacus foram submetidos à captura duas vezes ao dia por quatro dias e em seguida foram infectados com A. hydrophila (2,4x10(7) bactéria mL-1). Os tratamentos utilizados foram: controle sem infecção (CSI), controle com infecção (CCI) e tratados com 110,0; 140,0 e 170,0mgOTC.kg-1, e 5,0; 10,0 e 15,0mgFFC.kg-1. As variáveis de qualidade da água foram monitoradas diariamente. Após o tratamento, no CSI dos dois testes, ocorreu 100% de sobrevivência. Nos testes com OTC, no CCI, a sobrevivência foi de 29,2%; em 110,0mg.kg-1, 37,5%; em 140,0mg.kg-1, 29,2%; e em 170,0mg.kg-1, 50,0%. Nos testes com FFC, foi eficaz com 10,0mg.kg-1, e no CCI a sobrevivência foi de 76,9%; em 5,0mg.kg-1, 81,81%; em 10,0mg/L.kg-1, 100% e em 15,0mg.kg-1, 87,5%. A OTC, em concentrações de até 170,0mg.kg-1 de ração, não é eficaz para o controle de A. hydrophila em pacu, e o FFC é eficaz na concentração de 10,0mg.kg-1 e ambos não alteram as variáveis de qualidade de água.

Qualidade de vida em epilepsia e percepção de controle de crises

The individual affective-cognitive evaluations are important factors that control the way he feels the disease impact in his life. Then, the perception of seizure control is a more important factor to evaluate Quality of Life (QoL) than the illness characteristics, such as the severity, type, sickening period and seizure frequency. This study searched for the relationship among the subjective variables (perception of seizure control) and the illness characteristics to evaluate QoL. The sample consisted of 60 individuals with chronic epilepsy, aging 18 to 70 (M=37.05; SD=11.25), chosen at randon from the ambulatory of epilepsy - HC/UNICAMP, by the Questionnaire 65. The illness characteristics were not significant, except the seizures frequency, when associated to the impairment in QoL among controlled seizures and seizures with frequency higher than 10 per month (p=0.021). The perception of control was significantly associated to QoL (p=0.005).

Avaliação térmica de placas de argamassa de cimento e casca de arroz aquecidas por resistência elétrica

An alternative proposal for floor heating system by means of electric resistance for both chick and piggy installation is presented in this work. Several formulations of rice husk and cement mortar boards were used. An electronic device controlled all board temperature. This system presented a good efficiency design. The conventional cement mortar mixed with rice husk showed a better performance.

Sistema de sincronismo entre a colhedora de cana-de-açúcar e o veículo de transbordo

One of the problems found in mechanical harvest of sugar cane is the lack of synchronism between the harvest machine and the infield wagon, causing crop losses as well as operational capacity. The objective of the present research was to design a system capable of helping to synchronize the sugar cane harvest machine with the wagon. The communication between tractor and harvest machine is wireless. Two ultrasound sensors coupled to the elevator and a microprocessor manage such information, generating a correct synchronization among the machines. The system was tested in laboratory and on field performing its function adequately, maintaining the two machines in synchronization, indicating and alerting the operators their relative positions. The developed system reduced the sugar cane lost in 60 kg ha-1 comparing to the harvest with the system turned off.

Seed dispersal of Solanum thomasiifolium Sendtner (Solanaceae) in the Linhares Forest, Espírito Santo state, Brazil

The aim of this study was to analyse seed dispersal and establishment of Solanum thomasiifolium in an area of nativo vegetation in Espirito Santo state on the southeastern Brazilian coast. Ten species of birds, the crab-eating fox (Cerdocyon thous), and one species of lizard (Tropidurus torquatus) fed on S. thomasiifolium fruits and dispersed viable seeds in their faeces. The proportional contribution of each of these groups to seed dispersal was 77% (birds), 19% (crab-eating fox) and 4% (lizards). Ants also contributed to seed dispersal. More seeds were deposited in vegetation islands than in the surrounding open areas. Germination rates of seeds collected directly from fruit (control), bird droppings, the faeces of crab-eating foxes and lizards were, respectively, 64, 64, 53, and 80 %. Differences among these rates were all significant, except between birds and control. Lizards were important as seed carriers between nearby islands and they expelled a higher proportion of viable seeds. Birds and the crab-eating foxes did not enhance seed germination, but promoted seed dispersal over a wider area. Plant architecture, fruit productivity, fruit characteristics and the diversity of frugivores are important for the success of S. thomasiifolium in habitat colonization.

Folhas verdes, folhas secas, fibra do colmo e a clarificação do caldo de cana-de-açúcar

The presence of vegetal impurities in sugarcane delivered to sugarmills as green and dry leaves is a problem not only because they are non-value materials to be processed along with sugarcane stalks, but also because they can rise the color of the clarified juice and, consequently, the color of the sugar produced, with a reduction of its quality for the market. Another problem is the mud volume sedimented in the clarifiers, which also can result in a larger recirculation and greater volume of filtrate juice, with higher losses of sucrose and utilization of the vacuum rotary filters. The objective of this work was to observe the effect of the presence of green and dry leaves on sugarcane juice clarification, related to a control treatment with the addition of fiber extracted from the stalks. The experiments were planned based on the addition of quantities of fibrous sources in order to formulate samples with absolute increase of 0.25 , 0.50 and 0.75 percentual points over the fiber content of the sugarcane stalks (control treatment). The juice clarification was conducted with a laboratory clarifier. The clarified juice color and the mud volume were evaluated. The presence of green leaves caused higher color and mud volume due to the extraction of non-sucrose components of the leaves. Soluble compounds of dry leaves were also extracted, though not detected by juice analysis. The addition of the fiber extracted from the stalks did not induce alterations in the clarification process.

Atributos mecânicos e erosão por salpicamento em amostras de latossolo vermelho-amarelo sob efeito de vinhaça

The objective of this study was to quantify the effect of plonk on compressive behavior and mechanical attributes such as consistency, optimum moisture for compaction and maximum density of a Red-Yellow Latosol (Oxisol) to evaluate the effect of plonk and compaction state in splashed particles, from Lavras (MG) region. The plonk was obtained from an artisanal sugarcane brandy alembic. Undisturbed and disturbed soil samples were collected at 0 to 3 cm and 60 to 63 cm depths. Disturbed soil samples were used for soil characterization, determination of consistence limits and Normal Proctor essay after material incubation with plonk. Undisturbed soil samples were saturated with plonk or distilled water (control) during 48 hours for testing the compressibility and resistance to splash by using simulated rainfall. The plonk altered the consistence limits of studied layers. For the 0-3 cm layer, the plonk reduced the friable range, and for the 60-63 cm layer the effect was in the opposite direction. For both layers, the plonk increased Dmax and decreased Uoptimum. Regardless of the plonk treatment, both layers presented the same load support capacity. The compaction degree of samples influenced the splash erosion. The increase of the applied pressure over the samples resulted in increase of splash material quantity. At the 60-63 cm layer, the plonk treatment reduced the splash material quantity by increasing the applied pressure, mainly when the samples were at field capacity.

Medo, ansiedade e controle relacionados ao tratamento odontológico

The aim of this study was to test fear, anxiety and control related to dental treatment. The subjects were 364 children with ages between 7 and 13 years. Three questionnaires with multiple choice questions were applied in groups of 10 children. The first instrument was the 15-item dental subscale from the Children’s Fear Survey Schedule9. The subjects rated their level of fear on a 5-point scale. The second survey instrument was the 20-item subscale from the State Trait Anxiety Inventory for Children16. This measure was used to capture how anxious the child was, in general. The third instrument was the Child Dental Control Assessment19. It contained 20 items to assess perceived control and 20 items to assess desired control. The results of the survey indicated that dental fear and anxiety were slightly higher for females when compared with male subjects (P < 0.05). Older children (11 to 13 years old) obtained higher fear scores than younger ones (7 to 9 years old). Concerning perceived control, the results indicate that younger children perceive more control than older ones. For desired control, the results indicate that younger children reported higher percentages than older ones. In this study, patients who had undergone anesthesia during treatment revealed higher fear scores when compared with those who had not. Dental fear etiology seems to be related to a procedure that may involve pain or lack of control.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Assessment of ocular surface toxicity after topical instillation of nitric oxide donors

PURPOSE: To evaluate the ocular surface toxicity of two nitric oxide donors in ex vivo and in vivo animal models: S-nitrosoglutathione (GSNO) and S-nitroso-N-acetylcysteine (SNAC) in a hydroxypropyl methylcellulose (HPMC) matrix at final concentrations 1.0 and 10.0 mM. METHODS: Ex vivo GSNO and SNAC toxicities were clinically and histologically analyzed using freshly excised pig eyeballs. In vivo experiments were performed with 20 albino rabbits which were randomized into 4 groups (5 animals each): Groups 1 and 2 received instillations of 150 µL of aqueous HPMC solution containing GSNO 1.0 and 10.0 mM, respectively, in one of the eyes; Groups 3 and 4 received instillations of 150 µL of aqueous HPMC solution-containing SNAC 1.0 and 10.0 mM, respectively, in one of the eyes. The contralateral eyes in each group received aqueous HPMC as a control. All animals underwent clinical evaluation on a slit lamp and the eyes were scored according to a modified Draize eye test and were histologically analyzed. RESULTS: Pig eyeballs showed no signs of perforation, erosion, corneal opacity or other gross damage. These findings were confirmed by histological analysis. There was no difference between control and treated rabbit eyes according to the Draize eye test score in all groups (p>0.05). All formulations showed a mean score under 1 and were classified as non-irritating. There was no evidence of tissue toxicity in the histological analysis in all animals. CONCLUSION: Aqueous HPMC solutions containing GSNO and SNAC at concentrations up to 10.0 mM do not induce ocular irritation.

Efeitos de diferentes protocolos de treinamento físico sobre o controle autonômico e cardiorrespiratório em homens de meia-idade

Universidade Estadual de Campinas . Faculdade de Educação Física