Rate of undesirable events at beginning of academic year: retrospective cohort study.

OBJECTIVE: To determine whether an increase in the rate of undesirable events occurs after care provided by trainees at the beginning of the academic year. DESIGN: Retrospective cohort study using administrative and patient record data. SETTING: University affiliated hospital in Melbourne, Australia. PARTICIPANTS: 19,560 patients having an anaesthetic procedure carried out by first to fifth year trainees starting work for the first time at the hospital over a period of five years (1995-2000). MAIN OUTCOME MEASURES: Absolute event rates, absolute rate reduction, and rate ratios of undesirable events. RESULTS: The rate of undesirable events was higher at the beginning of the academic year compared with the rest of the year (absolute event rate 137 v 107 per 1000 patient hours, relative rate reduction 28%, P<0.001). The overall adjusted rate ratio for undesirable events was 1.40, 95% confidence interval 1.24 to 1.58. This excess risk was seen for all residents, regardless of their level of seniority. The excess risk decreased progressively after the first month, and the trend disappeared fully after the fourth month of the year (rate ratio for fourth month 1.21, 0.93 to 1.57). The most important decreases were for central and peripheral nerve injuries (relative difference 82%), inadequate oxygenation of the patient (66%), vomiting/aspiration in theatre (53%), and technical failures of tracheal tube placement (49%). CONCLUSIONS: The rate of undesirable events was greater among trainees at the beginning of the academic year regardless of their level of clinical experience. This suggests that several additional factors, such as knowledge of the working environment, teamwork, and communication, may contribute to the increase.

Bayesian decision procedures for dose-escalation based on evidence of undesirable events and therapeutic benefit.

In this paper, Bayesian decision procedures are developed for dose-escalation studies based on bivariate observations of undesirable events and signs of therapeutic benefit. The methods generalize earlier approaches taking into account only the undesirable outcomes. Logistic regression models are used to model the two responses, which are both assumed to take a binary form. A prior distribution for the unknown model parameters is suggested and an optional safety constraint can be included. Gain functions to be maximized are formulated in terms of accurate estimation of the limits of a therapeutic window or optimal treatment of the next cohort of subjects, although the approach could be applied to achieve any of a wide variety of objectives. The designs introduced are illustrated through simulation and retrospective implementation to a completed dose-escalation study. Copyright © 2006 John Wiley & Sons, Ltd.

Stressful Life Events and their Trajectories among Midlife Women: Observations from the Seattle Midlife Women's Health Study

Thesis (Ph.D.)--University of Washington, 2016-08

Sistema de notificação de eventos adversos : contributos para a melhoria da segurança do doente

RESUMO - Este estudo insere-se na temática dos sistemas de notificação de eventos adversos. Pretende-se compreender a necessidade e importância de implementação de um sistema de notificação de Eventos Adversos num hospital E.P.E. (entidade pública empresarial) de Lisboa. Apresenta como objectivo geral: •Identificar as principais características que um Sistema de Notificação de Eventos Adversos, Erros e Incidentes deve ter e com base nisso propor um formulário de notificação que assente numa lógica de aprendizagem e não numa perspectiva de culpabilização. Trata-se de um estudo exploratório, descritivo, quantitativo, transversal. Foi utilizado como instrumento de recolha de dados o inquérito por questionário. A amostra é constituída por 82 enfermeiros de um hospital de Lisboa, em que não está implementado sistema de notificação de eventos adversos. Após análise dos dados concluiu-se que: Quando ocorrem acontecimentos indesejáveis, os profissionais de enfermagem poucas vezes notificam; Os profissionais notificam com maior frequência quando o evento é grave e trágico; Os inquiridos apontam como principais factores para a ocorrência de eventos adversos/erros/incidentes no seu local de trabalho “falhas de comunicação” e “deficiente rácio enfermeiro/doente”; A maior parte dos inquiridos concorda com a implementação de um sistema de notificação de eventos adversos, erros e incidentes no hospital onde trabalham. O sistema deve ser de carácter obrigatório assegurando o anonimato. Espera-se que o presente trabalho seja um contributo importante, que entronque e potencie a política/estratégia definida pelo hospital para a área da segurança do doente.

Process planning methodology: dynamic short-term planning for off-site construction in Slovenia

Planning is a vital element of project management but it is still not recognized as a process variable. Its objective should be to outperform the initially defined processes, and foresee and overcome possible undesirable events. Detailed task-level master planning is unrealistic since one cannot accurately predict all the requirements and obstacles before work has even started. The process planning methodology (PPM) has thus been developed in order to overcome common problems of the overwhelming project complexity. The essential elements of the PPM are the process planning group (PPG), including a control team that dynamically links the production/site and management, and the planning algorithm embodied within two continuous-improvement loops. The methodology was tested on a factory project in Slovenia and in four successive projects of a similar nature. In addition to a number of improvement ideas and enhanced communication, the applied PPM resulted in 32% higher total productivity, 6% total savings and created a synergistic project environment.

An evaluation of a Bayesian method of dose escalation based on bivariate binary responses

Recently, various approaches have been suggested for dose escalation studies based on observations of both undesirable events and evidence of therapeutic benefit. This article concerns a Bayesian approach to dose escalation that requires the user to make numerous design decisions relating to the number of doses to make available, the choice of the prior distribution, the imposition of safety constraints and stopping rules, and the criteria by which the design is to be optimized. Results are presented of a substantial simulation study conducted to investigate the influence of some of these factors on the safety and the accuracy of the procedure with a view toward providing general guidance for investigators conducting such studies. The Bayesian procedures evaluated use logistic regression to model the two responses, which are both assumed to be binary. The simulation study is based on features of a recently completed study of a compound with potential benefit to patients suffering from inflammatory diseases of the lung.

Bayesian decision procedures for binary and continuous bivariate dose-escalation studies

In this paper, Bayesian decision procedures are developed for dose-escalation studies based on binary measures of undesirable events and continuous measures of therapeutic benefit. The methods generalize earlier approaches where undesirable events and therapeutic benefit are both binary. A logistic regression model is used to model the binary responses, while a linear regression model is used to model the continuous responses. Prior distributions for the unknown model parameters are suggested. A gain function is discussed and an optional safety constraint is included. Copyright (C) 2006 John Wiley & Sons, Ltd.

Desenvolvimento de um núcleo versátil e integrado de ferramentas CAD/CAE para a modelagem e simulação de peças mecânicas

Currently there is still a high demand for quality control in manufacturing processes of mechanical parts. This keeps alive the need for the inspection activity of final products ranging from dimensional analysis to chemical composition of products. Usually this task may be done through various nondestructive and destructive methods that ensure the integrity of the parts. The result generated by these modern inspection tools ends up not being able to geometrically define the real damage and, therefore, cannot be properly displayed on a computing environment screen. Virtual 3D visualization may help identify damage that would hardly be detected by any other methods. One may find some commercial softwares that seek to address the stages of a design and simulation of mechanical parts in order to predict possible damages trying to diminish potential undesirable events. However, the challenge of developing softwares capable of integrating the various design activities, product inspection, results of non-destructive testing as well as the simulation of damage still needs the attention of researchers. This was the motivation to conduct a methodological study for implementation of a versatile CAD/CAE computer kernel capable of helping programmers in developing softwares applied to the activities of design and simulation of mechanics parts under stress. In this research it is presented interesting results obtained from the use of the developed kernel showing that it was successfully applied to case studies of design including parts presenting specific geometries, namely: mechanical prostheses, heat exchangers and piping of oil and gas. Finally, the conclusions regarding the experience of merging CAD and CAE theories to develop the kernel, so as to result in a tool adaptable to various applications of the metalworking industry are presented

Epidemiologia das reações transfusionais imediatas no Hospital Amaral Carvalho de Jaú

Pós-graduação em Pesquisa e Desenvolvimento (Biotecnologia Médica) - FMB

Gestão de risco: a importância da resiliência em eventos indesejáveis

Atualmente, ferramentas e dados estatísticos são muito utilizados para avaliar as condições perigosas enquanto, por outro lado, as pessoas usam o julgamento para perceber o risco, que tem como base a cultura do risco. A percepção do risco muda conforme o ambiente no qual a pessoa está imersa, e se diferencia conforme a cultura. O objetivo desta pesquisa é conhecer qual o papel dos diversos atores envolvidos na gestão de riscos e como a resiliência ajuda nos eventos indesejáveis. Foram investigados onze eventos indesejáveis, com dez entrevistados em seis organizações, com o objetivo de identificar e analisar como a gestão de risco, a resiliência e a percepção do risco interagem. A análise multifacetada reforçou a importância dos aspectos de resiliência para uma gestão de risco eficaz. A participação dos possíveis envolvidos no evento, desde o contexto da gestão, reforçado pelo controle compartilhado, identificação das habilidades individuais não prescritas, incentivo à cooperação entre esses atores, comunicação eficaz e simplificação dos processos são aspectos integradores a uma gestão de risco. Como oportunidade de investigação futura, a pesquisa reforça a necessidade de analisar aspectos da cultura organizacional abrangendo as ciências sociais: antropologia, sociologia, psicodinâmica do trabalho, sociologia da ética e cultura país como agente consciente e experimentador da realidade.

Análise de confiabilidade de um moto-ventilador centrífugo: aplicação no sistema de pressurização de subestação industrial para garantia da segurança operacional na indústria petroquímica

The need of the oil industry to ensure the safety of the facilities, employees and the environment, not to mention the search for maximum efficiency of its facilities, makes it seeks to achieve a high level of excellence in all stages of its production processes in order to obtain the required quality of the final product. Know the reliability of equipment and what it stands for a system is of fundamental importance for ensuring the operational safety. The reliability analysis technique has been increasingly applied in the oil industry as fault prediction tool and undesirable events that can affect business continuity. It is an applied scientific methodology that involves knowledge in engineering and statistics to meet and or analyze the performance of components, equipment and systems in order to ensure that they perform their function without fail, for a period of time and under a specific condition. The results of reliability analyzes help in making decisions about the best maintenance strategy of petrochemical plants. Reliability analysis was applied on equipment (bike-centrifugal fan) between the period 2010-2014 at the Polo Petrobras Guamaré Industrial, situated in rural Guamaré municipality in the state of Rio Grande do Norte, where he collected data field, analyzed historical equipment and observing the behavior of faults and their impacts. The data were processed in commercial software reliability ReliaSoft BlockSim 9. The results were compared with a study conducted by the experts in the field in order to get the best maintenance strategy for the studied system. With the results obtained from the reliability analysis tools was possible to determine the availability of the centrifugal motor-fan and what will be its impact on the security of process units if it will fail. A new maintenance strategy was established to improve the reliability, availability, maintainability and decreased likelihood of Moto-Centrifugal Fan failures, it is a series of actions to promote the increased system reliability and consequent increase in cycle life of the asset. Thus, this strategy sets out preventive measures to reduce the probability of failure and mitigating aimed at minimizing the consequences.

Método de análise de vulnerabilidade utilizando redes complexas : aplicação na rede de transporte aéreo brasileira

Dissertação (mestrado)—Universidade de Brasília, Faculdade de Tecnologia, Departamento de Engenharia Civil e Ambiental, 2016.

Effects of a synthetic gonadotrophin-releasing hormone agonist, leuprolide, on rut-associated events in male red deer

This study examined the effectiveness of leuprolide, a gonadotrophin-releasing hormone agonist, in suppressing rut-associated events in farmed male red deer. In mid-January (~6 weeks before the rut period in the southern hemisphere) adult red deer (Cervus elaphus scoticus) stags that had been allocated to three groups (n = 10 per group) received leuprolide, administered subcutaneously in a 90-day release formulation, at zero (control), low (22.5 mg) or high (45 mg) doses. Following treatment with leuprolide there was evidence of suppression of mean plasma luteinising hormone concentration that was significant (P < 0.05) at 9 weeks. Mean plasma testosterone concentration of all three groups rose following treatment, then declined prematurely in the low- and high-dose leuprolide-treated groups, so that it was significantly (P < 0.05) suppressed (0.66 ± 0.29 and 2.0 ± 0.88 ng mL–1, low and high dose respectively) in early April when the peak value (9.0 ± 1.94 ng mL–1) was recorded from control stags. A reduction in mean liveweight occurred in all three groups through February–April and this did not differ among treatments. However, a corresponding reduction in mean body condition score was greater in the control stags (P < 0.05). There was little effect of leuprolide treatment on aggressive behaviours, but it lowered roaring frequency in the latter period of the rut. The results indicate that this gonadotrophin-releasing hormone agonist has potential for application in the deer farming industry to suppress undesirable effects of the rut.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.