Os jogos frutais e o poema: natureza viva; natureza-morta

The (usually rotten) fruit theme or motif is recurring in Ferreira Gullar‟s poetic work (from A luta corporal, 1954, to Em alguma parte alguma, 2010). It can be said that the semantic-metaphoric field comprises metapoetic to political and social issues –expressive aspects in the author‟s trajectory. Thus, starting from the fruit topic which is characteristic of the bucolic-pastoral poetic tradition and tracing its presence in Brazil, this paper aims, by analysing some of Gullar‟s poems, to reflect on the peculiar way the problem is subverted in his lyric.

Bacterial cellulose production by Gluconacetobacter xylinus by employing alternative culture media

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Variation in peach fruit susceptibility to Monilinia laxa and gene expression

Brown rot caused by Monilinia laxa and Monilinia fructigena is considered one of the most important diseases affecting Prunus species. Although some losses can result from the rotten fruits in the orchard, most of the damage is caused to fruits during the post-harvest phase. Several studies reported that brown rot incidence during fruit development highly varies; it was found that at a period corresponding to the the pit hardening stage, fruit susceptibility drastically decreases, to be quickly restored afterwards. However the molecular basis of this phenomenon is still not well understood. Furthermore, no difference in the rot incidence was found between wound and un-wound fruits, suggesting that resistance associated more to a specifc biochemical response of the fruit, rather than to a higher mechanical resistance. So far, the interaction Monilinia-peach was analyzed through chemical approaches. In this study, a bio-molecular approach was undertaken in order to reveal alteration in gene expression associated to the variation of susceptibility. In this thesis three different methods for gene expression analysis were used to analyze the alterations in gene expression occurring in peach fruits during the pit hardening stage, in a period encompassing the temporary change in Monilinia susceptibility: real time PCR, microarray and cDNA AFLP techniques. In 2005, peach fruits (cv.K2) were weekly harvested during a 19-week long-period, starting from the fourth week after full bloom, until full maturity. At each sampling time, three replicates of 5 fruits each were dipped in the M.laxa conidial suspension or in distilled water, as negative control. The fruits were maintained at room temperature for 3 hours; afterwards, they were peeled with a scalpel; the peel was immediately frozen in liquid nitrogen and transferred to -80 °C until use. The degree of susceptibility of peach fruit to the pathogen was determined on 3 replicates of 20 fruits each, as percentage of infected fruits, after one week at 20 °C. Real time PCR analysis was performed to study the variation in expression of those genes encoding for the enzymes of the phenylpropanoid pathway (phenylalanine ammonia lyase (PAL), chalcone synthase (CHS), cinnamate 4-hydroxylase (C4H), leucoanthocyanidine reductase (LAR), hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase (HQT) and of the jasmonate pathway, such as lipoxygenase (LOX), both involved in the production of important defense compounds. Alteration in gene expression was monitored on fruit samples of a period encompassing the pit hardening stage and the corresponding temporary resistance to M.laxa infections, weekly, from the 6thto the 12th week after full bloom (AFB) inoculated with M. laxa or mock-inoculated. The data suggest a critical change in the expression level of the phenylpropanoid pathway from the 7th to the 8th week AFB; such change could be directly physiologically associated to the peach growth and it could indirectly determine the decrease of susceptibility of peach fruit to Monilinia rot during the subsequent weeks. To investigate on the transcriptome variation underneath the temporary loss of susceptibility of peach fruits to Monilinia rot, the microarray and the cDNA AFLP techniques were used. The samples harvested on the 8th week AFB (named S, for susceptible ones) and on the 12th week AFB (named R, for resistant ones) were compared, both inoculated or mock-inoculated. The microarray experiments were carried out at the University of Padua (Dept. of Environmental Agronomy and Crop Science), using the μPEACH1.0 microarray together with the suited protocols. The analysis showed that 30 genes (corresponding to the 0.6% of the total sequences (4806) contained in the μPeach1.0 microarray) were found up-regulated and 31 ( 0.6%) down regulated in RH vs. SH fruits. On the other hand, 20 genes (0.4%) were shown to be up-regulated and 13 (0.3%) down-regulated in the RI vs. SI fruit. No genes were found differentially expressed in the mock-inoculated resistant fruits (RH) vs. the inoculated resistant ones (RI). Among the up-regulated genes an ATP sulfurylase, an heat shock protein 70, the major allergen Pru P1, an harpin inducing protein and S-adenosylmethionine decarboxylase were found, conversely among the down-regulated ones, cinnamyl alcohol dehydrogenase, an histidine- containing phosphotransfer protein and the ferritin were found. The microarray experimental results and the data indirectly derived, were tested by Real Time PCR analysis. cDNA AFLP analysis was also performed on the same samples. 339 transcript derived fragments considered significant for Monilinia resistance, were selected, sequenced and classified. Genes potentially involved in cell rescue and defence were well represented (8%); several genes (12.1%) involved in the protein folding, post-transductional modification and genes (9.2%) involved in cellular transport were also found. A further 10.3% of genes were classified as involved in the metabolism of aminoacid, carbohydrate and fatty acid. On the other hand, genes involved in the protein synthesis (5.7%) and in signal transduction and communication (5.7%) were found. Among the most interesting genes found differentially expressed between susceptible and resistant fruits, genes encoding for pathogenesis related (PR) proteins were found. To investigate on the association of Monilinia resistance and PR biological function, the major allergen Pru P1 (GenBank accession AM493970) and its isoform (here named Pru P2), were expressed in heterologous system and in vitro assayed for their anti-microbial activity. The ribonuclease activity of the recombinant Pru P1 and Pru P2 proteins was assayed against peach total RNA. As the other PR10 proteins, they showed a ribonucleolytic activity, that could be important to contrast pathogen penetration. Moreover Pru P1 and Pru P2 recombinant proteins were checked for direct antimicrobial activity. No inhibitory effect of Pru P1 or Pru P2 was detected against the selected fungi.

Molecular And Biochemical Characterization Of Caffeine Synthase And Purine Alkaloid Concentration In Guarana Fruit.

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.

Molecular Genetic Variability Of Commercial And Wild Accessions Of Passion Fruit (passiflora Spp.) Targeting Ex Situ Conservation And Breeding.

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Modeling The Effects Of Temperature And Ph On The Resistance Of Alicyclobacillus Acidoterrestris In Conventional Heat-treated Fruit Beverages Through A Meta-analysis Approach.

In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.

Malpighiaceae: correlations between habit, fruit type and basic chromosome number

The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Dynamic and steady: shear rheological properties of xanthan and guar gums dispersed in yellow passion fruit pulp (Passiflora edulis f. flavicarpa)

Yellow passion fruit pulp is unstable, presenting phase separation that can be avoided by the addition of hydrocolloids. For this purpose, xanthan and guar gum [0.3, 0.7 and 1.0% (w/w)] were added to yellow passion fruit pulp and the changes in the dynamic and steady - shear rheological behavior evaluated. Xanthan dispersions showed a more pronounced pseudoplasticity and the presence of yield stress, which was not observed in the guar gum dispersions. Cross model fitting to flow curves showed that the xanthan suspensions also had higher zero shear viscosity than the guar suspensions, and, for both gums, an increase in temperature led to lower values for this parameter. The gums showed different behavior as a function of temperature in the range of 5 - 35ºC. The activation energy of the apparent viscosity was dependent on the shear rate and gum concentration for guar, whereas for xanthan these values only varied with the concentration. The mechanical spectra were well described by the generalized Maxwell model and the xanthan dispersions showed a more elastic character than the guar dispersions, with higher values for the relaxation time. Xanthan was characterized as a weak gel, while guar presented a concentrated solution behavior. The simultaneous evaluation of temperature and concentration showed a stronger influence of the polysaccharide concentration on the apparent viscosity and the G' and G" moduli than the variation in temperature.

Alcohol dehydrogenase activities and ethanol tolerance in Anastrepha (Diptera, Tephritidae) fruit-fly species and their hybrids

The ADH (alcohol dehydrogenase) system is one of the earliest known models of molecular evolution, and is still the most studied in Drosophila. Herein, we studied this model in the genus Anastrepha (Diptera, Tephritidae). Due to the remarkable advantages it presents, it is possible to cross species with different Adh genotypes and with different phenotype traits related to ethanol tolerance. The two species studied here each have a different number of Adh gene copies, whereby crosses generate polymorphisms in gene number and in composition of the genetic background. We measured certain traits related to ethanol metabolism and tolerance. ADH specific enzyme activity presented gene by environment interactions, and the larval protein content showed an additive pattern of inheritance, whilst ADH enzyme activity per larva presented a complex behavior that may be explained by epistatic effects. Regression models suggest that there are heritable factors acting on ethanol tolerance, which may be related to enzymatic activity of the ADHs and to larval mass, although a pronounced environmental effect on ethanol tolerance was also observed. By using these data, we speculated on the mechanisms of ethanol tolerance and its inheritance as well as of associated traits.

Stability of fruit bases and chocolate fillings

Syrups with high sugar content and dehydrated fruits in its composition can be added to chocolate fillings to reduce the need of artificial flavor and dyes attributing a natural appeal to the product. Fruit bases were produced with lyophilized strawberry, passion fruit, and sliced orange peel. Rheological dynamic oscillatory tests were applied to determine the products stability and tendency of shelf life. Values of G´< G´´ were observed for strawberry and passion fruit flavor, whereas values of G´ > G´´ were found for orange flavor during the 90 days of storage. It was observed that shear stress values did not vary significantly suggesting product stability during the studied period. For all fillings, it was found a behavior similar to the fruit base indicating that it has great influence on the filling behavior and its stability. The use of a sugar matrix in fillings provided good shelf life for the fruit base, which could be kept under room temperature conditions for a period as long as one year. The good stability and storage conditions allow the use of fruit base for handmade products as well as for industrialized products.

Condições de atmosfera controlada para pêssegos "maciel" colhidos em dois estádios de maturação

O objetivo deste trabalho foi avaliar o efeito de duas temperaturas e condições de atmosfera controlada (AC) sobre a conservação de pêssegos da cultivar Maciel, colhidos em dois estádios de maturação. Os tratamentos avaliados foram: armazenamento refrigerado (AR) na temperatura de +0,5°C; AR na temperatura de -0,5°C; 2,0kPa O2 + 4,0kPa CO2 em -0,5°C; 1,0kPa O2 + 3,0kPa CO2 em -0,5°C; 2,0kPa O2 + 6,0kPa CO2 em -0,5°C. As avaliações foram realizadas após 60 dias de armazenamento e mais dois e quatro dias de exposição dos frutos à temperatura de 20ºC. Na análise realizada após dois meses de armazenamento, mais dois dias a 20°C, verificou-se que os frutos submetidos a 2,0kPa de O2 + 4,0 kPa de CO2 apresentaram maior firmeza de polpa em relação aos demais tratamentos, sendo que a mesma não foi influenciada pelo estádio de maturação. Os sólidos solúveis totais foram maiores em frutos com estádio de maturação maduro independente da condição de armazenamento. A ocorrência de podridões e escurecimento interno da polpa não foi influenciada pelo estádio de maturação. No entanto, a condição de AC de 1,0 kPa de O2 + 3,0kPa de CO2 proporcionou o menor percentual de podridões e escurecimento interno da polpa em relação aos demais tratamentos. Na avaliação realizada aos quatro dias de exposição a 20°C, os frutos colhidos no estádio maduro estavam completamente podres, independente da condição de armazenamento praticada.

OFFSPRING IN RESPONSE TO PARENTAL FEMALE DENSITIES IN THE FRUIT FLY PARASITOID DIACHASMIMORPHA LONGICAUDATA (HYMENOPTERA: BRACONIDAE: OPIINAE)

As part of an evaluation of the braconid parasitoid Diachasmimorpha longicaudata (Ashmead) as a biocontrol agent of Ceratitis capitata (Wiedemann) in Brazil, the aims in the current study were to find the best parental ratio of females to males in the rearing cages in order to get the highest female biased offspring in the parasitoid rearing process, and to verify the parasitism efficiency on C. capitata according to parental female densities. Three treatments were assessed: T1 (20 females: 20 males), T2 (60 females: 20 males) and T3 (100 females: 20 males). Ten late-third instars of C. capitata were offered daily to each female parasitoid from the 1st to the 12th d of age. The parental female productivity, fecundity, offspring sex ratio, percentage of parasitoid emergence, and daily mortality of parental females and males at different female/male densities were evaluated. The results indicated that numbers higher than 20 parental females did not affect offspring sex ratio, overall offspring production, nor the percent parasitism. Female biased offspring occurred in all three parental female/male ratios analyzed in this study, except that predominately males developed from parasitoid eggs laid in the age interval 1-2 d post emergence. Higher parasitoid female productivity and fecundity were found at the 1:1 female/male per cage density whereas lower productivity and fecundity were recorded at the 5:1 female/male ratio. Higher female/male ratio in the parental cages increased the mortality rate of females but did not influence the number of parental male deaths. The results may facilitate advancement of an optimum mass-rearing system to aid in control of C. capitata in Brazil.

Determination of banana fruit susceptibility to post-harvest diseases: wound anthracnose, quiescent anthracnose and crown rot

Introduction. This protocol aims at ( a) evaluating the resistance to post-harvest diseases within different genotypes of bananas, and ( b) comparing different origins of bananas ( geographic origin, physiological stage, etc.) for their susceptibility to post-harvest diseases. The principle, key advantages, starting plant material, time required and expected results are presented. Materials and methods. Materials required and details of the twelve steps of the protocol ( fruit sampling and inoculum preparation, wound anthracnose resistance study, quiescent anthracnose resistance study and crown-rot resistance study) are described. Results. Typical symptoms of the different diseases are obtained after artificial inoculation.